Gene Page:APBA1

Summary?
GeneID 320
Symbol APBA1
Synonyms D9S411E|LIN10|MINT1|X11|X11A|X11ALPHA
Description amyloid beta precursor protein binding family A member 1
Reference MIM:602414|HGNC:HGNC:578|Ensembl:ENSG00000107282|HPRD:03879|Vega:OTTHUMG00000019984
Gene type protein-coding
Map location 9q21.12
Pascal p-value 0.004
Fetal beta -0.469
Support CompositeSet
Darnell FMRP targets
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search 有限公司-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 4

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
DSTYK 0.85 0.87
TRAPPC10 0.84 0.86
BACE1 0.83 0.86
HLCS 0.82 0.85
DYNC1LI2 0.82 0.83
CDC42BPA 0.82 0.85
TGOLN2 0.82 0.85
GRB10 0.82 0.82
C9orf5 0.81 0.84
KIAA0232 0.81 0.84
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.21 -0.59 -0.53
C1orf54 -0.56 -0.56
C1orf61 -0.55 -0.59
GNG11 -0.53 -0.50
VAMP5 -0.53 -0.47
IL32 -0.52 -0.49
MT-CO2 -0.51 -0.49
ENHO -0.51 -0.52
AF347015.31 -0.51 -0.49
C16orf74 -0.51 -0.53

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005515 protein binding IPI 8887653
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007268 突触传递 TAS neuron, Synap, Neurotransmitter (GO term level: 6) 9753324
GO:0008088 axon cargo transport TAS axon (GO term level: 8) 9822620
GO:0007399 nervous system development TAS neurite (GO term level: 5) 9753324
GO:0007155 cell adhesion TAS 9753324
GO:0006461 protein complex assembly TAS 9614075|9753324
GO:0006886 intracellular protein transport TAS 9614075
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0008021 synaptic vesicle TAS Synap, Neurotransmitter (GO term level: 12) 9753324

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
APBB1 FE65 | MGC:9072 | RIR amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) X11alpha interacts with APP. BIND 11115513
应用程序 AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 amyloid beta (A4) precursor protein - HPRD,BioGRID 8887653
应用程序 AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 amyloid beta (A4) precursor protein 应用程序swe interacts with X11-alpha. BIND 12849748|14756819
应用程序 AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 amyloid beta (A4) precursor protein Beta-APP interacts with X11. BIND 8887653
CASK CAGH39 | CMG | FLJ22219 | FLJ31914 | LIN2 | MICPCH | TNRC8 calcium/calmodulin-dependent serine protein kinase (MAGUK family) X11-ALPHA interacts with Lin-2. BIND 9822620
CASK CAGH39 | CMG | FLJ22219 | FLJ31914 | LIN2 | MICPCH | TNRC8 calcium/calmodulin-dependent serine protein kinase (MAGUK family) - HPRD,BioGRID 9753324|9822620
|9952408|9822620|9952408
CCS MGC138260 copper chaperone for superoxide dismutase - HPRD,BioGRID 11115513
CCS MGC138260 copper chaperone for superoxide dismutase X11alpha interacts with CCS. BIND 11115513
CNTNAP3 CASPR3 | CNTNAP3A | rp11 - 138 l21.1 | rp11 - 290个地级.1 contactin associated protein-like 3 - HPRD,BioGRID 12093160
CNTNAP4 CASPR4 | KIAA1763 contactin associated protein-like 4 - HPRD,BioGRID 12093160
DLG1 DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlg discs, large homolog 1 (Drosophila) Affinity Capture-Western BioGRID 14960569
HTR2C 5-HT2C | 5-HTR2C | HTR1C 5-hydroxytryptamine (serotonin) receptor 2C - HPRD,BioGRID 12006486
KCNJ12 FLJ14167 | IRK2 | KCNJN1 | Kir2.2 | Kir2.2v | hIRK | hIRK1 | hkir2.2x | kcnj12x potassium inwardly-rectifying channel, subfamily J, member 12 - HPRD,BioGRID 14960569|15024025
KIF17 KIAA1405 | KIF17B | KIF3X kinesin family member 17 - HPRD 12514209
LIN7A LIN-7A | LIN7 | MALS-1 | MGC148143 | TIP-33 | VELI1 lin-7 homolog A (C. elegans) Affinity Capture-Western BioGRID 9822620
LIN7B LIN-7B | MALS-2 | MALS2 | VELI2 lin-7 homolog B (C. elegans) - HPRD,BioGRID 9753324
LIN7C FLJ11215 | LIN-7-C | LIN-7C | MALS-3 | MALS3 | VELI3 lin-7 homolog C (C. elegans) Affinity Capture-Western BioGRID 14960569
NOTCH1 TAN1 | hN1 Notch homolog 1, translocation-associated (Drosophila) Notch1 interacts with X11-alpha. This interaction was modelled on a demonstrated interaction between mouse Notch1 and human X11-alpha. BIND 14756819
NRXN1 DKFZp313P2036 | FLJ35941 | Hs.22998 | KIAA0578 neurexin 1 - HPRD,BioGRID 11036064
PSEN1 AD3 | FAD | PS1 | S182 presenilin 1 - HPRD 12196555
PSEN2 AD3L | AD4 | PS2 | STM2 presenilin 2 (Alzheimer disease 4) Affinity Capture-Western BioGRID 12196555
STX1A HPC-1 | STX1 | p35-1 syntaxin 1A (brain) - HPRD 9395480
STXBP1 EIEE4 | MUNC18-1 | UNC18 | hUNC18 | rbSec1 syntaxin binding protein 1 - HPRD 9395480


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN 169 118 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN 335 193 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
SCHLESINGER METHYLATED DE NOVO IN CANCER 88 64 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
LOPES METHYLATED IN COLON CANCER UP 27 20 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER LATE RECURRENCE DN 69 48 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080 713 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-103/107 60 66 1A hsa-miR-103brain AGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brain AGCAGCAUUGUACAGGGCUAUCA
miR-185 152 158 m8 hsa-miR-185brain UGGAGAGAAAGGCAGUUC
miR-24 533 540 1A,m8 hsa-miR-24SZ UGGCUCAGUUCAGCAGGAACAG