Gene Page:XIAP

Summary?
GeneID 331
Symbol XIAP
Synonyms API3|BIRC4|IAP-3|ILP1|MIHA|XLP2|hIAP-3|hIAP3
Description X-linked inhibitor of apoptosis
Reference MIM:300079|HGNC:HGNC:592|Ensembl:ENSG00000101966|HPRD:02094|Vega:OTTHUMG00000022336
Gene type protein-coding
Map location Xq25
Sherlock p-value 0.383
Fetal beta 0.192
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed的genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0781

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
snp_a-1882582 0 XIAP 331 0.13 trans
rs17115591 chr14 45262026 XIAP 331 0.13 trans
rs12917789 chr16 86029348 XIAP 331 0.19 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
APP 0.93 0.92
PRKAR1A 0.90 0.91
ATP2A2 0.89 0.91
RAB3GAP1 0.89 0.91
SYT11 0.89 0.86
AARS 0.89 0.89
NFE2L1 0.89 0.87
DCTN1 0.89 0.88
MAGEE1 0.88 0.88
M6PR 0.88 0.86
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.21 -0.55 -0.35
C1orf54 -0.52 -0.41
C1orf61 -0.51 -0.49
FAM159B -0.48 -0.49
GNG11 -0.47 -0.34
AL050337.1 -0.47 -0.35
AP002478.3 -0.46 -0.40
AC098691.2 -0.46 -0.38
IL32 -0.45 -0.32
SYCP3 -0.45 -0.37

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004869 cysteine protease inhibitor activity IEA -
GO:0005515 protein binding 新闻学会 11801603|16282325|16887178
GO:0016874 ligase activity IEA -
GO:0008270 zinc ion binding IEA -
GO:0043027 caspase inhibitor activity IDA 9230442
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006511 ubiquitin-dependent protein catabolic process IEA -
GO:0006916 anti-apoptosis TAS 8654366
GO:0043154 negative regulation of caspase activity IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005829 cytosol EXP 11257231
GO:0005829 cytosol TAS 8654366
GO:0005622 intracellular IEA -
GO:0005737 cytoplasm TAS 8654366

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ACVR1B ACTRIB | ACVRLK4 | ALK4 | SKR2 activin A receptor, type IB An unspecified isoform of ALK4 interacts with XIAP. This interaction was modeled on a demonstrated interaction between ALK4 from an unspecified species and human XIAP. BIND 11356828
ACVRL1 ACVRLK1 | ALK-1 | ALK1 | HHT | HHT2 | ORW2 | SKR3 | TSR-I activin A receptor type II-like 1 ALK1 interacts with XIAP. This interaction was modeled on a demonstrated interaction between ALK1 from an unspecified species and human XIAP. BIND 11356828
CASP2 CASP-2 | ICH-1L | ICH-1L/1S | ICH1 | NEDD2 caspase 2, apoptosis-related cysteine peptidase Phenotypic Suppression BioGRID 11832478
CASP3 CPP32 | CPP32B | SCA-1 caspase 3, apoptosis-related cysteine peptidase - HPRD 9230442|11447297
|11927604
CASP3 CPP32 | CPP32B | SCA-1 caspase 3, apoptosis-related cysteine peptidase XIAP interacts with Casp-3. BIND 15200957
CASP3 CPP32 | CPP32B | SCA-1 caspase 3, apoptosis-related cysteine peptidase Affinity Capture-Western
Co-crystal Structure
in vitro
in vivo
Reconstituted Complex		 BioGRID 9230442|9384571
|11257232|11447297
|11927604
CASP3 CPP32 | CPP32B | SCA-1 caspase 3, apoptosis-related cysteine peptidase Caspase-3 interacts with XIAP. BIND 15650747
CASP4 ICE(rel)II | ICEREL-II | ICH-2 | Mih1/TX | TX caspase 4, apoptosis-related cysteine peptidase Affinity Capture-Western BioGRID 11927604
CASP6 MCH2 caspase 6, apoptosis-related cysteine peptidase XIAP interacts with Casp-6. BIND 15200957
CASP7 CMH-1 | ICE-LAP3 | MCH3 caspase 7, apoptosis-related cysteine peptidase XIAP interacts with caspase-7. BIND 15580265
CASP7 CMH-1 | ICE-LAP3 | MCH3 caspase 7, apoptosis-related cysteine peptidase - HPRD 9230442|11359776
CASP7 CMH-1 | ICE-LAP3 | MCH3 caspase 7, apoptosis-related cysteine peptidase Caspase-7 interacts with XIAP. BIND 15650747
CASP7 CMH-1 | ICE-LAP3 | MCH3 caspase 7, apoptosis-related cysteine peptidase in vitro
in vivo
Reconstituted Complex		 BioGRID 9230442|9384571
|11257232|11359776
CASP7 CMH-1 | ICE-LAP3 | MCH3 caspase 7, apoptosis-related cysteine peptidase XIAP interacts with Casp-7. BIND 15200957
CASP8 ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473 caspase 8, apoptosis-related cysteine peptidase Phenotypic Suppression BioGRID 11832478
CASP9 APAF-3 | APAF3 | CASPASE-9c | ICE-LAP6 | MCH6 caspase 9, apoptosis-related cysteine peptidase XIAP interacts with and ubiquitinates Caspase-9. BIND 15300255
CASP9 APAF-3 | APAF3 | CASPASE-9c | ICE-LAP6 | MCH6 caspase 9, apoptosis-related cysteine peptidase Affinity Capture-Western
Far Western
Reconstituted Complex
Two-hybrid		 BioGRID 9545235|11390657
|15280366|16189514
CASP9 APAF-3 | APAF3 | CASPASE-9c | ICE-LAP6 | MCH6 caspase 9, apoptosis-related cysteine peptidase - HPRD 9545235|11927604
CHEK1 CHK1 CHK1 checkpoint homolog (S. pombe) Reconstituted Complex BioGRID 14759516
COMMD1 C2orf5 | MGC27155 | MURR1 copper metabolism (Murr1) domain containing 1 - HPRD 14685242
DIABLO DIABLO-S | FLJ10537 | FLJ25049 | SMAC | SMAC3 diablo homolog (Drosophila) Smac interacts with XIAP. BIND 15650747
DIABLO DIABLO-S | FLJ10537 | FLJ25049 | SMAC | SMAC3 diablo homolog (Drosophila) XIAP interacts with and ubiquitinates SMAC. BIND 15300255
DIABLO DIABLO-S | FLJ10537 | FLJ25049 | SMAC | SMAC3 diablo homolog (Drosophila) - HPRD,BioGRID 10929712
DYNLL2 DNCL1B | Dlc2 | MGC17810 dynein, light chain, LC8-type 2 Two-hybrid BioGRID 16189514
GSPT1 551G9.2 | ETF3A | FLJ38048 | FLJ39067 | GST1 | eRF3a G1 to S phase transition 1 - HPRD,BioGRID 12865429
HTRA2 OMI | PARK13 | PRSS25 HtrA serine peptidase 2 - HPRD,BioGRID 11604410
HTRA2 OMI | PARK13 | PRSS25 HtrA serine peptidase 2 XIAP interacts with HtrA2. BIND 15300255
MAGED1 DLXIN-1 | NRAGE melanoma antigen family D, 1 - HPRD,BioGRID 11546791
MAP3K7 TAK1 | TGF1a mitogen-activated protein kinase kinase kinase 7 - HPRD,BioGRID 12048196
MAP3K7IP1 3'-Tab1 | MGC57664 | TAB1 mitogen-activated protein kinase kinase kinase 7 interacting protein 1 - HPRD,BioGRID 9878061
MAP3K7IP1 3'-Tab1 | MGC57664 | TAB1 mitogen-activated protein kinase kinase kinase 7 interacting protein 1 XIAP interacts with TAB1. BIND 9878061
MAP3K7IP2 FLJ21885 | KIAA0733 | TAB2 mitogen-activated protein kinase kinase kinase 7 interacting protein 2 - HPRD,BioGRID 12048196
STRADB ALS2CR2 | CALS-21 | ILPIP | ILPIPA | MGC102916 | PAPK | PRO1038 STE20-related kinase adaptor beta - HPRD,BioGRID 12048196
TGFBR1 AAT5 | ACVRLK4 | ALK-5 | ALK5 | LDS1A | LDS2A | SKR4 | TGFR-1 transforming growth factor, beta receptor 1 TGF-beta-RI interacts with XIAP. This interaction was modeled on a demonstrated interaction between TGF-beta-RI from an unspecified species and human XIAP. BIND 11356828
TRAF6 MGC:3310 | RNF85 TNF receptor-associated factor 6 - HPRD,BioGRID 12048196
WDYHV1 C8orf32 | FLJ10204 WDYHV motif containing 1 Two-hybrid BioGRID 16189514
XAF1 BIRC4BP | HSXIAPAF1 | XIAPAF1 XIAP associated factor 1 - HPRD,BioGRID 11175744
XIAP API3 | BIRC4 | ILP1 | MIHA | XLP2 X-linked inhibitor of apoptosis Two-hybrid BioGRID 16189514


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG UBIQUITIN MEDIATED PROTEOLYSIS 138 98 All SZGR 2.0 genes in this pathway
KEGG APOPTOSIS 88 62 All SZGR 2.0 genes in this pathway
KEGG FOCAL ADHESION 201 138 All SZGR 2.0 genes in this pathway
KEGG NOD LIKE RECEPTOR SIGNALING PATHWAY 62 47 All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER 328 259 All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER 84 67 All SZGR 2.0 genes in this pathway
BIOCARTA BCELLSURVIVAL PATHWAY 16 10 All SZGR 2.0 genes in this pathway
BIOCARTA CASPASE PATHWAY 23 15 All SZGR 2.0 genes in this pathway
BIOCARTA HIVNEF PATHWAY 58 43 All SZGR 2.0 genes in this pathway
BIOCARTA DEATH PATHWAY 33 24 All SZGR 2.0 genes in this pathway
BIOCARTA MITOCHONDRIA PATHWAY 21 15 All SZGR 2.0 genes in this pathway
SA CASPASE CASCADE 19 13 All SZGR 2.0 genes in this pathway
ST FAS SIGNALING PATHWAY 65 54 All SZGR 2.0 genes in this pathway
PID P75 NTR PATHWAY 69 51 All SZGR 2.0 genes in this pathway
PID BMP PATHWAY 42 31 All SZGR 2.0 genes in this pathway
PID CASPASE PATHWAY 52 39 All SZGR 2.0 genes in this pathway
PID TGFBR PATHWAY 55 38 All SZGR 2.0 genes in this pathway
REACTOME APOPTOSIS 148 94 All SZGR 2.0 genes in this pathway
REACTOME INTRINSIC PATHWAY FOR APOPTOSIS 30 21 All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN 634 384 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN 352 225 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
MARKS HDAC TARGETS DN 15 11 All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP 207 128 All SZGR 2.0 genes in this pathway
DUTTA APOPTOSIS VIA NFKB 33 25 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN 514 319 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX 795 478 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
KUROKAWA LIVER CANCER CHEMOTHERAPY DN 41 28 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS RESPONSE 35 28 All SZGR 2.0 genes in this pathway
SU SALIVARY GLAND 16 9 All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM DN 86 66 All SZGR 2.0 genes in this pathway
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 419 273 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP 953 554 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP 783 442 All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN 270 181 All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP 245 159 All SZGR 2.0 genes in this pathway
LEE RECENT THYMIC EMIGRANT 227 128 All SZGR 2.0 genes in this pathway
DANG MYC TARGETS UP 143 100 All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC 1103 714 All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS DN 207 139 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP 279 155 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-122 2640 2646 1A hsa-miR-122a UGGAGUGUGACAAUGGUGUUUGU
miR-17-5p/20/93.mr/106/519.d 1228 1234 1A hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrain UAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZ UAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZ CAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUGU
miR-186 6778 6785 1A,m8 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU
miR-200bc/429 1255 1261 m8 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
miR-23 1017 1024 1A,m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-27 6748 6754 1A hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-323 3114 3121 1A,m8 hsa-miR-323brain GCACAUUACACGGUCGACCUCU
hsa-miR-323brain GCACAUUACACGGUCGACCUCU
miR-330 1049 1055 m8 hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-34b 1218 1224 1A hsa-miR-34b UAGGCAGUGUCAUUAGCUGAUUG
miR-494 1112 1118 1A hsa-miR-494brain UGAAACAUACACGGGAAACCUCUU
miR-495 1245 1251 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-7 1168 1174 1A hsa-miR-7SZ UGGAAGACUAGUGAUUUUGUUG
miR-96 1012 1018 m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC