基因页面:DNAJB1

Summary?
GeneID 3337
Symbol DNAJB1
Synonyms HSPF1 | Hdj1 |商品p40|RSPH16B|Sis1
Description DnaJ heat shock protein family (Hsp40) member B1
Reference MIM:604572|HGNC:HGNC:5270|Ensembl:ENSG00000132002|HPRD:05198|Vega:OTTHUMG00000183289
Gene type protein-coding
Map location 19p13.2
Pascal p-value 0.005
Sherlock p-value 0.796
Fetal beta 0.242
DMG 1 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg01083584 19 14629193 DNAJB1 3.956E-4 -0.209 0.043 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs7593761 chr2 197275602 DNAJB1 3337 0.01 trans
rs12641054 chr4 113071694 DNAJB1 3337 0.1 trans
rs10868543 chr9 89852686 DNAJB1 3337 0.01 trans
rs906309 chr15 98304785 DNAJB1 3337 0.12 trans
rs9920555 chr15 98417871 DNAJB1 3337 0.15 trans
rs10492782 chr16 13210707 DNAJB1 3337 0.01 trans
rs7215675 chr17 10905819 DNAJB1 3337 0.09 trans
rs16944595 chr17 11242834 DNAJB1 3337 0.03 trans
rs8120542 chr20 24395092 DNAJB1 3337 0.18 trans
rs8114637 chr20 24395207 DNAJB1 3337 0.18 trans
rs9974024 chr20 24397274 DNAJB1 3337 0.18 trans
rs6515493 chr20 24401635 DNAJB1 3337 0.18 trans
rs6049703 chr20 24432425 DNAJB1 3337 0 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
NLGN1 0.77 0.52
TIAM2 0.77 0.52
SEMA3A 0.75 0.52
LIMCH1 0.75 0.54
TGFBR1 0.75 0.55
AL590362.2 0.75 0.49
SORCS1 0.74 0.46
EML1 0.74 0.59
KCTD12 0.73 0.51
FAM59A 0.73 0.58
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
TNFSF12 -0.43 -0.43
SERPINB6 -0.43 -0.40
PTH1R -0.40 -0.45
AC007405.8 -0.40 -0.43
SLC9A3R2 -0.40 -0.36
SLC16A11 -0.40 -0.42
TMEM54 -0.40 -0.39
TSC22D4 -0.40 -0.48
C5orf53 -0.40 -0.45
HSD17B14 -0.40 -0.45

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0031072 heat shock protein binding IEA -
GO:0051082 unfolded protein binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006457 protein folding IEA -
GO:0006986 response to unfolded protein TAS 8975727
GO:0051085 chaperone cofactor-dependent protein folding IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN 634 384 All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE UP 136 80 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING UP 176 123 All SZGR 2.0 genes in this pathway
NAGASHIMA EGF SIGNALING UP 58 40 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN 459 276 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR UP 164 122 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR UP 162 116 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN 508 354 All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP 239 157 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP 612 367 All SZGR 2.0 genes in this pathway
WANG ESOPHAGUS CANCER VS NORMAL DN 101 66 All SZGR 2.0 genes in this pathway
YORDY RECIPROCAL REGULATION BY ETS1 AND SP100 DN 87 48 All SZGR 2.0 genes in this pathway
WOOD EBV EBNA1 TARGETS UP 110 71 All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP 414 287 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
NAKAYAMA FRA2 TARGETS 43 27 All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC 8HR 5 DN 11 8 All SZGR 2.0 genes in this pathway
SUH COEXPRESSED WITH ID1 AND ID2 UP 19 14 All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648 385 All SZGR 2.0 genes in this pathway
MORI SMALL PRE BII LYMPHOCYTE DN 76 52 All SZGR 2.0 genes in this pathway
UEDA CENTRAL CLOCK 88 62 All SZGR 2.0 genes in this pathway
MENSSEN MYC目标 53 35 All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN 337 230 All SZGR 2.0 genes in this pathway
LEI MYB TARGETS 318 215 All SZGR 2.0 genes in this pathway
GERY CEBP TARGETS 126 90 All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D9 28 15 All SZGR 2.0 genes in this pathway
ZAMORA NOS2 TARGETS UP 69 41 All SZGR 2.0 genes in this pathway
MARCHINI TRABECTEDIN RESISTANCE UP 21 16 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 8HR UP 105 73 All SZGR 2.0 genes in this pathway
CHIBA RESPONSE TO TSA 50 31 All SZGR 2.0 genes in this pathway
GERHOLD ADIPOGENESIS DN 64 44 All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION DN 98 67 All SZGR 2.0 genes in this pathway
ZHENG RESPONSE TO ARSENITE UP 18 14 All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS PEAK AT 2HR 51 36 All SZGR 2.0 genes in this pathway
MCCLUNG COCAIN REWARD 4WK 75 47 All SZGR 2.0 genes in this pathway
KYNG RESPONSE TO H2O2 VIA ERCC6 17 9 All SZGR 2.0 genes in this pathway
VISALA RESPONSE TO HEAT SHOCK AND AGING DN 14 12 All SZGR 2.0 genes in this pathway
KYNG RESPONSE TO H2O2 71 42 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN 911 527 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN 1011 592 All SZGR 2.0 genes in this pathway
HELLER SILENCED BY METHYLATION DN 105 67 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN 292 189 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION DN 281 179 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP 973 570 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP 425 298 All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR UP 294 199 All SZGR 2.0 genes in this pathway
PODAR RESPONSE TO ADAPHOSTIN UP 147 98 All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP 259 185 All SZGR 2.0 genes in this pathway
SHEDDEN肺癌A5生存良好 70 32 All SZGR 2.0 genes in this pathway
KYNG RESPONSE TO H2O2 VIA ERCC6 DN 46 31 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 182 102 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 M 216 124 All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP 756 494 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549 316 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137 655 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882 538 All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE NOT VIA P38 337 236 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-137 552 559 1A,m8 hsa-miR-137 UAUUGCUUAAGAAUACGCGUAG
miR-143 497 503 1A hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
miR-155 1145 1152 1A,m8 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGG
miR-19 831 838 1A,m8 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
miR-543 121 127 m8 hsa-miR-543 AAACAUUCGCGGUGCACUUCU
miR-9 1112 1118 m8 hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA