Gene Page:HTR5A

Summary?
GeneID 3361
Symbol HTR5A
Synonyms 5-HT5A
Description 5-hydroxytryptamine receptor 5A
Reference MIM:601305|HGNC:HGNC:5300|HPRD:03198|
Gene type protein-coding
Map location 7q36.1
Pascal p-value 2.992E-4
Fetal beta -3.476
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
ADT:Sun_2012 系统的Investigation of Antipsychotic Drugs and Their Targets A total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes.
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统的search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 2 Link to SZGene
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs1578978 chr8 118196802 HTR5A 3361 0.2 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004993 serotonin receptor activity TAS serotonin, Neurotransmitter (GO term level: 8) 7988681
GO:0004872 receptor activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007186 G-protein coupled receptor protein signaling pathway TAS 7988681
GO:0007165 signal transduction IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005886 plasma membrane IEA -
GO:0005887 integral to plasma membrane TAS 7988681

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG CALCIUM SIGNALING PATHWAY 178 134 All SZGR 2.0 genes in this pathway
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION 272 195 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS 305 177 All SZGR 2.0 genes in this pathway
REACTOME AMINE LIGAND BINDING RECEPTORS 38 33 All SZGR 2.0 genes in this pathway
REACTOME SEROTONIN RECEPTORS 12 11 All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805 368 All SZGR 2.0 genes in this pathway
REACTOME G ALPHA I SIGNALLING EVENTS 195 114 All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408 246 All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP 390 236 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED 228 119 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-504 117 124 1A,m8 hsa-miR-504 AGACCCUGGUCUGCACUCUAU