Gene Page:HTR7
Summary?
| GeneID | 3363 |
| Symbol | HTR7 |
| Synonyms | 5-HT7 |
| Description | 5-hydroxytryptamine receptor 7 |
| Reference | MIM:182137|HGNC:HGNC:5302|Ensembl:ENSG00000148680|HPRD:01639|Vega:OTTHUMG00000018732 |
| Gene type | protein-coding |
| Map location | 10q21-q24 |
| Pascal p-value | 0.076 |
| Fetal beta | -0.262 |
| Support | GPCR SIGNALLING CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| ADT:Sun_2012 | Systematic Investigation of Antipsychotic Drugs and Their Targets | A total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes. | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Xu_2012 | Whole Exome Sequencing analysis | 新创4基因的突变被交货确认ome sequencing of 795 samples in this study | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
DNM table
DNM table| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| HTR7 | chr10 | 92508680 | C | T | NM_000872 NM_019859 NM_019860 |
p.404R>Q p.404R>Q p.404R>Q |
missense missense missense |
Schizophrenia | DNM:Xu_2012 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FOXF1 | 0.82 | 0.79 |
| APOLD1 | 0.80 | 0.65 |
| ADAMTS1 | 0.77 | 0.71 |
| LRRC32 | 0.77 | 0.79 |
| ACOT11 | 0.74 | 0.66 |
| GPR37L1 | 0.73 | 0.69 |
| TPCN1 | 0.73 | 0.72 |
| BTG2 | 0.72 | 0.77 |
| TGM2 | 0.72 | 0.80 |
| ZFP36 | 0.72 | 0.77 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FRG1 | -0.51 | -0.62 |
| MED19 | -0.50 | -0.59 |
| ASNSD1 | -0.49 | -0.57 |
| COQ3 | -0.48 | -0.59 |
| C18orf21 | -0.48 | -0.59 |
| POLB | -0.48 | -0.61 |
| PAK1IP1 | -0.48 | -0.57 |
| RP9 | -0.48 | -0.57 |
| GNL3 | -0.47 | -0.56 |
| MED7 | -0.47 | -0.57 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004993 | serotonin receptor activity | TAS | serotonin, Neurotransmitter (GO term level: 8) | 8226867 |
| GO:0004872 | receptor activity | IEA | - | |
| GO:0004977 | melanocortin receptor activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 8226867 |
| GO:0007187 | 蛋白信号,以及环核苷酸second messenger | TAS | 8226867 | |
| GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
| GO:0007165 | signal transduction | IEA | - | |
| GO:0008015 | blood circulation | TAS | 8226867 | |
| GO:0007623 | circadian rhythm | TAS | 8398139 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | TAS | 8226867 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
| KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS | 305 | 177 | All SZGR 2.0 genes in this pathway |
| REACTOME AMINE LIGAND BINDING RECEPTORS | 38 | 33 | All SZGR 2.0 genes in this pathway |
| REACTOME SEROTONIN RECEPTORS | 12 | 11 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA S SIGNALLING EVENTS | 121 | 82 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
| PEPPER CHRONIC LYMPHOCYTIC LEUKEMIA UP | 33 | 28 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| DIERICK SEROTONIN FUNCTION GENES | 6 | 6 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER WITH H3K27ME3 UP | 295 | 149 | All SZGR 2.0 genes in this pathway |
| YAUCH HEDGEHOG SIGNALING PARACRINE DN | 264 | 159 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 1HR UP | 61 | 44 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-218 | 241 | 247 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-29 | 283 | 289 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-376c | 1197 | 1203 | 1A | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
| miR-378 | 631 | 637 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
| miR-493-5p | 1486 | 1492 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-504 | 567 | 573 | m8 | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.