Gene Page:INSR

Summary?
GeneID 3643
Symbol INSR
Synonyms CD220|HHF5
Description insulin receptor
Reference MIM:147670|HGNC:HGNC:6091|Ensembl:ENSG00000171105|HPRD:00975|Vega:OTTHUMG00000181992
Gene type protein-coding
Map location 19p13.3-p13.2
Pascal p-value 0.009
Fetal beta 0.407
DMG 1 (# studies)
eGene Myers' cis & trans
Support Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1
网络 Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0449

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg13976219 19 7197166 INSR 4.646E-4 -0.233 0.046 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs2860173 chr19 7129085 INSR 3643 0.13 cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
共有269个时间点秘密策划,n =38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004714 transmembrane receptor protein tyrosine kinase activity IEA neurite (GO term level: 8) -
GO:0000166 nucleotide binding IEA -
GO:0004872 receptor activity IEA -
GO:0004716 receptor signaling protein tyrosine kinase activity IDA 6849137
GO:0005159 胰岛素样生长因子受体结合 IDA 8452530
GO:0005009 insulin receptor activity IDA 8440175
GO:0005524 ATP binding IEA -
GO:0005525 GTP binding IDA 9092559
GO:0016740 transferase activity IEA -
GO:0042169 SH2 domain binding IPI 8276809
GO:0031994 insulin-like growth factor I binding IPI 8452530
GO:0031995 insulin-like growth factor II binding IPI 12138094
GO:0043548 phosphoinositide 3-kinase binding IPI 7537849|8276809
GO:0043559 insulin binding IDA 8440175
GO:0043560 insulin receptor substrate binding IPI 7537849|7559478
GO:0051425 PTB domain binding IPI 7559478
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0000187 activation of MAPK activity IMP 17001305
GO:0003007 heart morphogenesis IMP 7693131
GO:0030238 male sex determination IEA -
GO:0007186 G-protein coupled receptor protein signaling pathway IDA 9092559
GO:0007169 transmembrane receptor protein tyrosine kinase signaling pathway IEA -
GO:0006468 protein amino acid phosphorylation IEA -
GO:0005975 carbohydrate metabolic process IEA -
GO:0008286 insulin receptor signaling pathway IDA 8440175
GO:0042593 glucose homeostasis IMP 7693131
GO:0032583 gene-specific转录调节 IMP 12881524
GO:0019087 transformation of host cell by virus IMP 17001305
GO:0051290 protein heterotetramerization IDA 1898103
GO:0030335 positive regulation of cell migration IMP 12138094
GO:0045740 positive regulation of DNA replication IMP 12138094
GO:0045821 positive regulation of glycolysis IMP 7693131
GO:0045995 regulation of embryonic development IMP 7693131
GO:0046777 protein amino acid autophosphorylation IMP 7537849
GO:0048639 positive regulation of developmental growth IMP 7693131
GO:0045429 positive regulation of nitric oxide biosynthetic process IMP 10747347
GO:0060267 positive regulation of respiratory burst IDA 9092559
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005792 microsome IDA 8452530
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0005901 caveola IDA 15182363
GO:0005886 plasma membrane EXP 2986535
GO:0005886 plasma membrane IEA -
GO:0005887 integral to plasma membrane IDA 9092559
GO:0010008 endosome membrane EXP 2986535

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ACP1 HAAP | MGC111030 | MGC3499 acid phosphatase 1, soluble - HPRD 1304913
AHSG A2HS | AHS | FETUA | HSGA alpha-2-HS-glycoprotein - HPRD,BioGRID 7906861
CAV1 CAV | MSTP085 | VIP21 caveolin 1, caveolae protein, 22kDa - HPRD,BioGRID 10598578
CSK MGC117393 c-src tyrosine kinase CSK interacts with IR. BIND 10026153
CSK MGC117393 c-src tyrosine kinase - HPRD,BioGRID 10026153
DOK5 C20orf180 | MGC16926 docking protein 5 - HPRD 12730241
ENPP1 M6S1 | NPP1 | NPPS | PC-1 | PCA1 | PDNP1 ectonucleotide pyrophosphatase/phosphodiesterase 1 - HPRD,BioGRID 10615944
FRS2 FRS2A | FRS2alpha | SNT | SNT-1 | SNT1 fibroblast growth factor receptor substrate 2 - HPRD,BioGRID 10650943
GAB1 - GRB2-associated binding protein 1 Two-hybrid BioGRID 9658397
GRB10 GRB-IR | Grb-10 | IRBP | KIAA0207 | MEG1 | RSS growth factor receptor-bound protein 10 Grb10 interacts with IR. BIND 9506989
GRB10 GRB-IR | Grb-10 | IRBP | KIAA0207 | MEG1 | RSS growth factor receptor-bound protein 10 - HPRD,BioGRID 7479769|8621530
GRB14 - growth factor receptor-bound protein 14 - HPRD,BioGRID 9748281|11726652
GRB2 ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 growth factor receptor-bound protein 2 Affinity Capture-Western BioGRID 9083103
GRB7 - growth factor receptor-bound protein 7 - HPRD,BioGRID 10803466
HMGA1 HMG-R | HMGA1A | HMGIY | MGC12816 | MGC4242 | MGC4854 high mobility group AT-hook 1 HMGA1 interacts with INSR locus. BIND 15924147
HRAS C-BAS/HAS | C-H-RAS | C-HA-RAS1 | CTLO | H-RASIDX | HAMSV | HRAS1 | K-RAS | N-RAS | RASH1 v-Ha-ras Harvey rat sarcoma viral oncogene homolog - HPRD,BioGRID 3109943
IGF2 C11orf43 | FLJ22066 | FLJ44734 | INSIGF | pp9974 insulin-like growth factor 2 (somatomedin A) - HPRD,BioGRID 9722981
INPPL1 SHIP2 inositol polyphosphate phosphatase-like 1 Affinity Capture-Western BioGRID 12504111
INS ILPR | IRDN insulin - HPRD 2550426
INSRR IRR insulin receptor-related receptor - HPRD,BioGRID 8916919
IRS1 HIRS-1 insulin receptor substrate 1 IRS-1 interacts with IR. This interaction was modeled on a demonstrated interaction between rat IRS-1 and human IR. BIND 10026153
IRS1 HIRS-1 insulin receptor substrate 1 Insulin Receptor Substrate-1 Binds to the Insulin Receptor. This interaction is modeled on demonstrated interaction between human IR and rat IRS-1 BIND 8626379
IRS1 HIRS-1 insulin receptor substrate 1 - HPRD,BioGRID 11606564
IRS2 - insulin receptor substrate 2 - HPRD,BioGRID 8626379
IRS2 - insulin receptor substrate 2 Insulin Receptor Substrate-2 Binds to the Insulin Receptor. This interaction is modeled on demonstrated interaction between human IR and murine IRS-2. BIND 8626379
JAK1 JAK1A | JAK1B | JTK3 Janus kinase 1 (a protein tyrosine kinase) Phosphorylated IR-beta interacts with JAK-1. BIND 9492017
KHDRBS1 FLJ34027 | Sam68 | p62 KH domain containing, RNA binding, signal transduction associated 1 Affinity Capture-Western BioGRID 11604231
MAPK1 ERK | ERK2 | ERT1 | MAPK2 | P42MAPK | PRKM1 | PRKM2 | p38 | p40 | p41 | p41mapk mitogen-activated protein kinase 1 Affinity Capture-Western BioGRID 11409918
MAPK3 ERK1 | HS44KDAP | HUMKER1A | MGC20180 | P44ERK1 | P44MAPK | PRKM3 mitogen-activated protein kinase 3 - HPRD,BioGRID 11409918
NAMPT 1110035O14Rik | DKFZp666B131 | MGC117256 | PBEF | PBEF1 | VF | VISFATIN nicotinamide phosphoribosyltransferase PBEF interacts with IR. BIND 15604363
PIK3R1 GRB1 | p85 | p85-ALPHA phosphoinositide-3-kinase, regulatory subunit 1 (alpha) INSR (IR) interacts with PIK3R1. This interaction was modeled on a demonstrated interaction between INSR and PIK3R1 from unspecified species. BIND 15735664
PIK3R1 GRB1 | p85 | p85-ALPHA phosphoinositide-3-kinase, regulatory subunit 1 (alpha) The insulin receptor (IR) interacts with p85-alpha. BIND 8603569
PIK3R3 DKFZp686P05226 | FLJ41892 | p55 | p55-GAMMA phosphoinositide-3-kinase, regulatory subunit 3 (gamma) - HPRD,BioGRID 9524259
PRKCD MAY1 | MGC49908 | PKCD | nPKC-delta protein kinase C, delta - HPRD,BioGRID 11266508
PTPN1 PTP1B protein tyrosine phosphatase, non-receptor type 1 - HPRD,BioGRID 8826975
PTPN11 BPTP3 | CFC | MGC14433 | NS1 | PTP-1D | PTP2C | SH-PTP2 | SH-PTP3 | SHP2 protein tyrosine phosphatase, non-receptor type 11 - HPRD,BioGRID 7493946|8135823
PTPN12 PTP-PEST | PTPG1 protein tyrosine phosphatase, non-receptor type 12 - HPRD,BioGRID 8454633
PTPN6 HCP | HCPH | HPTP1C | PTP-1C | SH-PTP1 | SHP-1 | SHP-1L | SHP1 protein tyrosine phosphatase, non-receptor type 6 - HPRD,BioGRID 7512963
PTPRF FLJ43335 | FLJ45062 | FLJ45567 | LAR protein tyrosine phosphatase, receptor type, F - HPRD,BioGRID 1321126
RAF1 CRAF | NS5 | Raf-1 | c-Raf v-raf-1 murine leukemia viral oncogene homolog 1 - HPRD 11409918
RASA1 CM-AVM | CMAVM | DKFZp434N071 | GAP | PKWS | RASA | RASGAP | p120GAP | p120RASGAP RAS p21 protein activator (GTPase activating protein) 1 - HPRD,BioGRID 1331107
SH2B1 DKFZp547G1110 | FLJ30542 | KIAA1299 | SH2-B | SH2B SH2B adaptor protein 1 - HPRD,BioGRID 9742218|10594240
SH2B2 APS SH2B adaptor protein 2 - HPRD 10196204
SHC1 FLJ26504 | SHC | SHCA SHC (Src homology 2 domain containing) transforming protein 1 - HPRD 9083103
SHC1 FLJ26504 | SHC | SHCA SHC (Src homology 2 domain containing) transforming protein 1 Tyrosine-phosphorylated IR interacts with Shc. This interaction was modeled on a demonstrated interaction between human IR and Shc from an unspecified species. BIND 10340378
SMAD2 JV18 | JV18-1 | MADH2 | MADR2 | MGC22139 | MGC34440 | hMAD-2 | hSMAD2 SMAD family member 2 - HPRD,BioGRID 9092546
SNX1 HsT17379 | MGC8664 | SNX1A | Vps5 sorting nexin 1 - HPRD,BioGRID 9819414
SNX2 MGC5204 | TRG-9 sorting nexin 2 - HPRD,BioGRID 9819414
SNX4 - sorting nexin 4 - HPRD,BioGRID 9819414
SNX6 MGC3157| MSTP010 | TFAF2 sorting nexin 6 - HPRD,BioGRID 11279102
SOCS1 CIS1 | CISH1 | JAB | SOCS-1 | SSI-1 | SSI1 | TIP3 suppressor of cytokine signaling 1 Suppressors of cytokine signaling-1 associates with and inhibits the insulin receptor. BIND 11342531
SOCS3 ATOD4 | CIS3 | Cish3 | MGC71791 | SOCS-3 | SSI-3 | SSI3 suppressor of cytokine signaling 3 - HPRD,BioGRID 11071852|12560330
SOCS6 CIS4 | HSPC060 | SOCS4 | SSI4 | STAI4 | STATI4 suppressor of cytokine signaling 6 Suppressors of cytokine signaling-6 associates with and inhibits the insulin receptor. This interaction is modeled on demonstrated interaction between human IR and murine SOCS-6. BIND 11342531
SORBS1 CAP | DKFZp451C066 | DKFZp586P1422 | FLAF2 | FLJ12406 | KIAA1296 | R85FL | SH3D5 | SH3P12 | SORB1 sorbin and SH3 domain containing 1 - HPRD,BioGRID 11374898
SYNCRIP GRY-RBP | HNRPQ1 | NSAP1 | RP1-3J17.2 | dJ3J17.2 | hnRNP-Q | pp68 synaptotagmin binding, cytoplasmic RNA interacting protein - HPRD,BioGRID 11994298
VAV1 VAV vav 1 guanine nucleotide exchange factor - HPRD,BioGRID 7535775
VAV3 FLJ40431 vav 3 guanine nucleotide exchange factor - HPRD,BioGRID 11094073


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ADHERENS JUNCTION 75 53 All SZGR 2.0 genes in this pathway
KEGG INSULIN SIGNALING PATHWAY 137 103 All SZGR 2.0 genes in this pathway
KEGG TYPE II DIABETES MELLITUS 47 41 All SZGR 2.0 genes in this pathway
KEGG ALDOSTERONE REGULATED SODIUM REABSORPTION 42 29 All SZGR 2.0 genes in this pathway
BIOCARTA HDAC PATHWAY 32 25 All SZGR 2.0 genes in this pathway
BIOCARTA GH PATHWAY 28 22 All SZGR 2.0 genes in this pathway
BIOCARTA INSULIN PATHWAY 22 16 All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY 45 32 All SZGR 2.0 genes in this pathway
PID PTP1B PATHWAY 52 40 All SZGR 2.0 genes in this pathway
PID TCPTP PATHWAY 43 33 All SZGR 2.0 genes in this pathway
PID INSULIN GLUCOSE PATHWAY 26 24 All SZGR 2.0 genes in this pathway
REACTOME INSULIN RECEPTOR RECYCLING 23 9 All SZGR 2.0 genes in this pathway
REACTOME INSULIN RECEPTOR SIGNALLING CASCADE 87 64 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY INSULIN RECEPTOR 108 72 All SZGR 2.0 genes in this pathway
REACTOME SIGNAL ATTENUATION 14 8 All SZGR 2.0 genes in this pathway
REACTOME PI3K CASCADE 71 51 All SZGR 2.0 genes in this pathway
REACTOME SHC RELATED EVENTS 17 13 All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN 634 384 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN 116 79 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN 352 225 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP 380 236 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN 508 354 All SZGR 2.0 genes in this pathway
WANG BARRETTS ESOPHAGUS AND ESOPHAGUS CANCER UP 26 12 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355 243 All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS 205 145 All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN 712 443 All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN 203 134 All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS DN 103 59 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX 230 156 All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648 385 All SZGR 2.0 genes in this pathway
FERNANDEZ BOUND BY MYC 182 116 All SZGR 2.0 genes in this pathway
MANALO HYPOXIA UP 207 145 All SZGR 2.0 genes in this pathway
URS ADIPOCYTE DIFFERENTIATION UP 74 51 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
CHEN LVAD SUPPORT OF FAILING HEART UP 103 69 All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP 262 186 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR 681 420 All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE 246 153 All SZGR 2.0 genes in this pathway
HILLION HMGA1 TARGETS 90 71 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN 353 226 All SZGR 2.0 genes in this pathway
OUYANG PROSTATE CANCER MARKERS 19 16 All SZGR 2.0 genes in this pathway
LABBE TARGETS OF TGFB1 AND WNT3A DN 108 68 All SZGR 2.0 genes in this pathway
LEE LIVER CANCER SURVIVAL UP 185 112 All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED 351 238 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S3 266 180 All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN 225 124 All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC 1103 714 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G1 S 147 76 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP 504 321 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP 344 215 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658 397 All SZGR 2.0 genes in this pathway
GUO TARGETS OF IRS1 AND IRS2 98 67 All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP 279 155 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
let-7/98 2393 2400 1A,m8 hsa-let-7abrain UGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrain UGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrain UGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrain AGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrain UGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrain UGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brain UGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZ UGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrain UGAGGUAGUAGUUUGUGCUGU
miR-128 194 200 1A hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-15/16/195/424/497 577 583 m8 hsa-miR-15abrain UAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brain UAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrain UAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZ UAGCAGCACAGAAAUAUUGGC
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497 CAGCAGCACACUGUGGUUUGU
miR-379 2391 2397 m8 hsa-miR-379brain UGGUAGACUAUGGAACGUA
miR-496 2323 2330 1A,m8 hsa-miR-496 AUUACAUGGCCAAUCUC