Gene Page:IRF1
Summary?
GeneID | 3659 |
Symbol | IRF1 |
Synonyms | IRF-1|MAR |
Description | interferon regulatory factor 1 |
Reference | MIM:147575|HGNC:HGNC:6116|Ensembl:ENSG00000125347|HPRD:00961|Vega:OTTHUMG00000059497 |
Gene type | protein-coding |
Map location | 5q31.1 |
Pascal p-value | 0.095 |
Sherlock p-value | 0.963 |
Fetal beta | -0.854 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg22594055 | 5 | 131832675 | IRF1 | 2.02E-8 | -0.009 | 6.99E-6 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1342707 | chr1 | 147264296 | IRF1 | 3659 | 0 | trans | ||
rs10495652 | chr2 | 17139288 | IRF1 | 3659 | 0.03 | trans | ||
rs6531271 | chr2 | 17139932 | IRF1 | 3659 | 0.03 | trans | ||
rs12620194 | chr2 | 17148003 | IRF1 | 3659 | 0.03 | trans | ||
rs277655 | chr3 | 100044586 | IRF1 | 3659 | 0.17 | trans | ||
rs6551878 | chr4 | 65690588 | IRF1 | 3659 | 0.04 | trans | ||
rs10516136 | chr5 | 176381368 | IRF1 | 3659 | 0.1 | trans | ||
rs9397692 | chr6 | 154487314 | IRF1 | 3659 | 0.07 | trans | ||
rs9384190 | chr6 | 154524473 | IRF1 | 3659 | 0.14 | trans | ||
rs1111835 | chr13 | 79482717 | IRF1 | 3659 | 0.11 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/IRF1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SELPLG | 0.81 | 0.81 |
CSF1R | 0.81 | 0.82 |
CYBB | 0.79 | 0.75 |
P2RY13 | 0.79 | 0.70 |
APBB1IP | 0.78 | 0.77 |
PTPRC | 0.77 | 0.77 |
LAPTM5 | 0.77 | 0.77 |
CTSS | 0.75 | 0.72 |
P2RY12 | 0.74 | 0.72 |
LPAR5 | 0.73 | 0.74 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
BCL7C | -0.34 | -0.41 |
RP9P | -0.30 | -0.41 |
SH2B2 | -0.30 | -0.30 |
AC132872.1 | -0.29 | -0.29 |
SNHG12 | -0.28 | -0.30 |
ST20 | -0.28 | -0.34 |
PPP1R14B | -0.28 | -0.37 |
NUDT8 | -0.28 | -0.23 |
FAM167B | -0.28 | -0.29 |
RPL23A | -0.28 | -0.34 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006350 | transcription | IEA | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
GO:0045084 | positive regulation of interleukin-12 biosynthetic process | IEA | - | |
GO:0045786 | negative regulation of cell cycle | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
CSNK2A1 | CK2A1 | CKII | casein kinase 2, alpha 1 polypeptide | An unspecified isoform of CK2-alpha interacts with IRF-1 promoter. | BIND | 15893730 |
CSNK2B | CK2B | CK2N | CSK2B | G5A | MGC138222 | MGC138224 | casein kinase 2, beta polypeptide | CK2-beta interacts with IRF-1 promoter. | BIND | 15893730 |
CTDP1 | CCFDN | FCP1 | CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 | 连续油管与IRF-1交互的一个未指明的同种型promoter. | BIND | 15893730 |
DR1 | NC2 | NC2-BETA | down-regulator of transcription 1, TBP-binding (negative cofactor 2) | Dr1 interacts with IRF-1 promoter. | BIND | 15893730 |
DRAP1 | NC2-alpha | DR1-associated protein 1 (negative cofactor 2 alpha) | DRAP1 interacts with IRF-1 promoter. | BIND | 15893730 |
ERCC3 | BTF2 | GTF2H | RAD25 | TFIIH | XPB | excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing) | TFIIH interacts with IRF-1 promoter. | BIND | 15893730 |
GTF2F1 | BTF4 | RAP74 | TF2F1 | TFIIF | general transcription factor IIF, polypeptide 1, 74kDa | TFIIF interacts with IRF-1 promoter. | BIND | 15893730 |
HMGA1 | HMG-R | HMGA1A | HMGIY | MGC12816 | MGC4242 | MGC4854 | high mobility group AT-hook 1 | - | HPRD,BioGRID | 10357819 |
IRF8 | H-ICSBP | ICSBP | ICSBP1 | IRF-8 | interferon regulatory factor 8 | - | HPRD,BioGRID | 7768900|9742224 |
KAT2A | GCN5 | GCN5L2 | MGC102791 | PCAF-b | hGCN5 | K(lysine) acetyltransferase 2A | Reconstituted Complex | BioGRID | 10022868 |
KAT2B | CAF | P | P/CAF | PCAF | K(lysine) acetyltransferase 2B | - | HPRD,BioGRID | 10022868|11304541 |
MED23 | CRSP130 | CRSP133 | CRSP3 | DKFZp434H0117 | DRIP130 | SUR2 | mediator complex subunit 23 | An unspecified isoform of MED23 interacts with IRF-1 promoter. | BIND | 15893730 |
NFKB1 | DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105 | nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 | - | HPRD | 8746784 |
POLR2D | HSRBP4 | HSRPB4 | RBP4 | polymerase (RNA) II (DNA directed) polypeptide D | Rbp4 interacts with IRF-1 promoter. | BIND | 15893730 |
POLR2D | HSRBP4 | HSRPB4 | RBP4 | polymerase (RNA) II (DNA directed) polypeptide D | Rbp4 interacts with IRF-1. | BIND | 15893730 |
STAT1 | DKFZp686B04100 | ISGF-3 | STAT91 | signal transducer and activator of transcription 1, 91kDa | - | HPRD,BioGRID | 10764778 |
SUB1 | MGC102747 | P15 | PC4 | p14 | SUB1 homolog (S. cerevisiae) | PC4 interacts with IRF-1 promoter. | BIND | 15893730 |
TBP | GTF2D | GTF2D1 | MGC117320 | MGC126054 | MGC126055 | SCA17 | TFIID | TATA box binding protein | TBP interacts with IRF-1 promoter. | BIND | 15893730 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID TELOMERASE PATHWAY | 68 | 48 | All SZGR 2.0 genes in this pathway |
PID REG GR PATHWAY | 82 | 60 | All SZGR 2.0 genes in this pathway |
PID IFNG PATHWAY | 40 | 34 | All SZGR 2.0 genes in this pathway |
PID IL6 7 PATHWAY | 47 | 40 | All SZGR 2.0 genes in this pathway |
PID IL12 STAT4 PATHWAY | 33 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME TRAF6 MEDIATED IRF7 ACTIVATION | 30 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME因素参与巨核细胞培养MENT AND PLATELET PRODUCTION | 132 | 101 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON GAMMA SIGNALING | 63 | 48 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON ALPHA BETA SIGNALING | 64 | 50 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON SIGNALING | 159 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME RIG I MDA5 MEDIATED INDUCTION OF IFN ALPHA BETA PATHWAYS | 73 | 57 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
REACTOME INNATE IMMUNE SYSTEM | 279 | 178 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER UP | 206 | 111 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA DN | 77 | 52 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP | 211 | 136 | All SZGR 2.0 genes in this pathway |
BARIS THYROID CANCER DN | 59 | 45 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 XPCS UP | 28 | 16 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 2 | 127 | 92 | All SZGR 2.0 genes in this pathway |
RASHI NFKB1 TARGETS | 19 | 18 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE UP | 134 | 93 | All SZGR 2.0 genes in this pathway |
BOWIE RESPONSE TO EXTRACELLULAR MATRIX | 17 | 11 | All SZGR 2.0 genes in this pathway |
BOWIE RESPONSE TO TAMOXIFEN | 18 | 10 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
YAN ESCAPE FROM ANOIKIS | 24 | 19 | All SZGR 2.0 genes in this pathway |
SASAI RESISTANCE TO NEOPLASTIC TRANSFROMATION | 50 | 31 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
BENPORATH ES CORE NINE CORRELATED | 100 | 68 | All SZGR 2.0 genes in this pathway |
SHIN B CELL LYMPHOMA CLUSTER 1 | 13 | 11 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP | 223 | 140 | All SZGR 2.0 genes in this pathway |
GRANDVAUX IFN RESPONSE NOT VIA IRF3 | 14 | 10 | All SZGR 2.0 genes in this pathway |
DER IFN ALPHA RESPONSE UP | 74 | 48 | All SZGR 2.0 genes in this pathway |
RADAEVA RESPONSE TO IFNA1 UP | 52 | 40 | All SZGR 2.0 genes in this pathway |
DER IFN BETA RESPONSE UP | 102 | 67 | All SZGR 2.0 genes in this pathway |
BROCKE APOPTOSIS REVERSED BY IL6 | 144 | 98 | All SZGR 2.0 genes in this pathway |
DER IFN GAMMA RESPONSE UP | 71 | 45 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
ABBUD LIF SIGNALING 1 UP | 46 | 29 | All SZGR 2.0 genes in this pathway |
ZHAN V2 LATE DIFFERENTIATION GENES | 45 | 34 | All SZGR 2.0 genes in this pathway |
NATSUME RESPONSE TO INTERFERON BETA UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
JIANG VHL TARGETS | 138 | 91 | All SZGR 2.0 genes in this pathway |
ZHU CMV ALL UP | 120 | 89 | All SZGR 2.0 genes in this pathway |
GEISS RESPONSE TO DSRNA UP | 38 | 29 | All SZGR 2.0 genes in this pathway |
HEDENFALK BREAST CANCER BRCA1 VS BRCA2 | 163 | 113 | All SZGR 2.0 genes in this pathway |
ZHU CMV 24 HR UP | 93 | 65 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 11 | 57 | 40 | All SZGR 2.0 genes in this pathway |
WALLACE PROSTATE CANCER RACE UP | 299 | 167 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
ISHIKAWA STING SIGNALING | 8 | 6 | All SZGR 2.0 genes in this pathway |
FERRARI RESPONSE TO FENRETINIDE UP | 22 | 16 | All SZGR 2.0 genes in this pathway |
ICHIBA GRAFT VERSUS HOST DISEASE D7 UP | 107 | 67 | All SZGR 2.0 genes in this pathway |
PARK TRETINOIN RESPONSE AND PML RARA FUSION | 30 | 21 | All SZGR 2.0 genes in this pathway |
ZHANG INTERFERON RESPONSE | 23 | 14 | All SZGR 2.0 genes in this pathway |
HINATA NFKB TARGETS KERATINOCYTE UP | 91 | 63 | All SZGR 2.0 genes in this pathway |
HINATA NFKB TARGETS FIBROBLAST UP | 84 | 60 | All SZGR 2.0 genes in this pathway |
LIU VAV3 PROSTATE CARCINOGENESIS UP | 89 | 61 | All SZGR 2.0 genes in this pathway |
WORSCHECH TUMOR EVASION AND TOLEROGENICITY DN | 14 | 11 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA LB DN | 44 | 23 | All SZGR 2.0 genes in this pathway |
TIAN TNF SIGNALING VIA NFKB | 28 | 21 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 2HR UP | 39 | 30 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
KIM GLIS2 TARGETS UP | 84 | 61 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
KRIEG KDM3A TARGETS NOT HYPOXIA | 208 | 107 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
PHONG TNF TARGETS UP | 63 | 43 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
GHANDHI DIRECT IRRADIATION DN | 33 | 23 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
ZWANG EGF INTERVAL DN | 214 | 124 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 680 | 686 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-130/301 | 410 | 417 | 1A,m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-17-5p/20/93.mr/106/519.d | 589 | 595 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-23 | 487 | 494 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 487 | 493 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-383 | 618 | 625 | 1A,m8 | hsa-miR-383brain | AGAUCAGAAGGUGAUUGUGGCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.