Gene Page:KCND2
Summary?
GeneID | 3751 |
Symbol | KCND2 |
Synonyms | KV4.2|RK5 |
Description | potassium voltage-gated channel subfamily D member 2 |
Reference | MIM:605410|HGNC:HGNC:6238|Ensembl:ENSG00000184408|HPRD:09254|Vega:OTTHUMG00000156989 |
Gene type | protein-coding |
Map location | 7q31 |
Pascal p-value | 0.641 |
Sherlock p-value | 0.076 |
Fetal beta | -1.097 |
DMG | 1 (# studies) |
Support | EXCITABILITY CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0018 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg25241964 | 7 | 119912723 | KCND2 | 2.17E-8 | -0.013 | 7.31E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/KCND2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
EXOC4 | 0.88 | 0.92 |
SLC37A3 | 0.87 | 0.90 |
TMEM185A | 0.87 | 0.89 |
GPR85 | 0.87 | 0.87 |
POLR1B | 0.86 | 0.89 |
NCOA5 | 0.86 | 0.90 |
TDG | 0.86 | 0.90 |
NKAIN2 | 0.86 | 0.82 |
TSPAN14 | 0.85 | 0.89 |
TBC1D14 | 0.85 | 0.89 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AIFM3 | -0.67 | -0.74 |
AF347015.31 | -0.67 | -0.81 |
FXYD1 | -0.66 | -0.82 |
MT-CO2 | -0.66 | -0.82 |
TSC22D4 | -0.66 | -0.76 |
HEPN1 | -0.65 | -0.73 |
C5orf53 | -0.65 | -0.70 |
HLA-F | -0.65 | -0.73 |
HSD17B14 | -0.65 | -0.76 |
S100B | -0.65 | -0.78 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | 新闻学会 | 11287421 | |
GO:0005515 | protein binding | NAS | 11102480 | |
GO:0005244 | voltage-gated ion channel activity | IEA | - | |
GO:0005249 | voltage-gated potassium channel activity | NAS | 11102480 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0030955 | potassium ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 11102480 |
GO:0001508 | regulation of action potential | TAS | 11102480 | |
GO:0006811 | ion transport | IEA | - | |
GO:0006813 | potassium ion transport | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0043197 | dendritic spine | NAS | Synap, dendrite (GO term level: 7) | 11102480 |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0009986 | cell surface | IDA | 12493773 | |
GO:0008076 | voltage-gated potassium channel complex | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
REACTOME VOLTAGE GATED POTASSIUM CHANNELS | 43 | 32 | All SZGR 2.0 genes in this pathway |
REACTOME POTASSIUM CHANNELS | 98 | 68 | All SZGR 2.0 genes in this pathway |
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP | 351 | 230 | All SZGR 2.0 genes in this pathway |
WATTEL AUTONOMOUS THYROID ADENOMA UP | 73 | 47 | All SZGR 2.0 genes in this pathway |
KIM MYCL1 AMPLIFICATION TARGETS UP | 13 | 11 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 12HR UP | 116 | 79 | All SZGR 2.0 genes in this pathway |
SCHAEFFER前列腺癌发展48小时 | 487 | 286 | All SZGR 2.0 genes in this pathway |
LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
MCCLUNG COCAINE REWARD 5D | 79 | 62 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE DN | 264 | 159 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF ICP WITH H3K27ME3 | 206 | 108 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3 | 126 | 83 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3 | 137 | 85 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
SERVITJA ISLET HNF1A TARGETS UP | 163 | 111 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 1598 | 1604 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-129-5p | 341 | 347 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-140 | 158 | 164 | m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
miR-149 | 1742 | 1748 | 1A | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
miR-186 | 487 | 493 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-200bc/429 | 693 | 699 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-205 | 458 | 464 | 1A | hsa-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
miR-218 | 236 | 242 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-324-3p | 497 | 503 | 1A | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
miR-324-5p | 655 | 661 | m8 | hsa-miR-324-5p | CGCAUCCCCUAGGGCAUUGGUGU |
miR-33 | 332 | 338 | 1A | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
miR-338 | 2412 | 2419 | 1A,m8 | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
miR-362 | 2389 | 2395 | 1A | hsa-miR-362 | AAUCCUUGGAACCUAGGUGUGAGU |
miR-363 | 615 | 621 | 1A | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
miR-539 | 645 | 652 | 1A,m8 | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
mir - 93. - hd / 291-3p/294/295/302/372/373/520 | 574 | 580 | 1A | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.