Gene Page:KCND3

Summary?
GeneID 3752
Symbol KCND3
Synonyms BRGDA9 | KCND3L | KCND3S | KSHIVB |千伏4.3|SCA19|SCA22
Description potassium voltage-gated channel subfamily D member 3
Reference MIM:605411|HGNC:HGNC:6239|Ensembl:ENSG00000171385|HPRD:16104|Vega:OTTHUMG00000011989
Gene type protein-coding
Map location 1p13.3
Pascal p-value 1.238E-4
Fetal beta -0.212
DMG 2 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 3
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 3
GSMA_I Genome scan meta-analysis Psr: 0.0235

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg07723921 1 112531332 KCND3 3.333E-4 0.364 0.041 DMG:Wockner_2014
cg15211908 1 112531263 KCND3 3.488E-4 0.526 0.041 DMG:Wockner_2014
cg11947011 1 112531838 KCND3 3.87E-8 -0.017 1.1E-5 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SLC2A6 0.78 0.81
SLC45A1 0.78 0.85
SYNGR3 0.78 0.81
SLC27A4 0.77 0.85
MGAT5B 0.77 0.85
CYB561 0.76 0.79
SYT7 0.76 0.80
TMEM8B 0.76 0.79
GABBR2 0.76 0.77
ABCG4 0.75 0.79
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AL139819.3 -0.42 -0.49
AF347015.18 -0.39 -0.40
AF347015.8 -0.39 -0.39
NSBP1 -0.39 -0.46
AP002478.3 -0.39 -0.46
MT-ATP8 -0.38 -0.39
RAB13 -0.38 -0.48
AF347015.21 -0.38 -0.38
AF347015.26 -0.37 -0.33
AF347015.31 -0.36 -0.37

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding IEA -
GO:0005244 voltage-gated ion channel activity IEA -
GO:0005249 voltage-gated potassium channel activity IEA -
GO:0005250 A-type (transient outward) potassium channel activity TAS 8734615
GO:0008270 zinc ion binding IEA -
GO:0030955 potassium ion binding IEA -
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006811 ion transport IEA -
GO:0006813 potassium ion transport TAS 8734615
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0008076 voltage-gated potassium channel complex TAS 8734615

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME NEURONAL SYSTEM 279 221 All SZGR 2.0 genes in this pathway
REACTOME VOLTAGE GATED POTASSIUM CHANNELS 43 32 All SZGR 2.0 genes in this pathway
REACTOME POTASSIUM CHANNELS 98 68 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP 783 507 All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP 332 228 All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN 258 141 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP 530 342 All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN 193 112 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM5 94 59 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD UP 222 139 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP 487 303 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP 428 266 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR 681 420 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER NORMAL LIKE UP 476 285 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701 446 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP 221 150 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS HCP WITH H3 UNMETHYLATED 80 50 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA DN 267 160 All SZGR 2.0 genes in this pathway
MIKKELSEN ES HCP WITH H3K27ME3 41 30 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS DN 207 139 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882 538 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-148/152 127 133 1A hsa-miR-148a UCAGUGCACUACAGAACUUUGU
hsa-miR-152brain UCAGUGCAUGACAGAACUUGGG
hsa-miR-148b UCAGUGCAUCACAGAACUUUGU