Gene Page:VWC2

Summary?
GeneID 375567
Symbol VWC2
Synonyms PSST739|UNQ739
Description von Willebrand factor C domain containing 2
Reference MIM:611108|HGNC:HGNC:30200|HPRD:18271|
Gene type protein-coding
Map location 7p12.2
Pascal p-value 0.034
Sherlock p-value 0.452
Fetal beta -2.198
DMG 1 (# studies)
eGene Nucleus accumbens basal ganglia

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg23436746 7 49815938 VWC2 1.197E-4 0.45 0.029 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Biological process GO term Evidence Neuro keywords PubMed ID
GO:0045666 positive regulation of neuron differentiation ISS neuron (GO term level: 10) 17400546
GO:0030514 negative regulation of BMP signaling pathway ISS 17400546
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005615 extracellular space ISS 17400546

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
HATADA METHYLATED IN LUNG CANCER UP 390 236 All SZGR 2.0 genes in this pathway
HARRIS BRAIN CANCER PROGENITORS 44 23 All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP 250 168 All SZGR 2.0 genes in this pathway
RAY TUMORIGENESIS BY ERBB2 CDC25A UP 104 57 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS 344 197 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
mir - 369 - 3 - p 260 266 1A hsa - mir - 369 - 3 - p AAUAAUACAUGGUUGAUCUUU
miR-374 260 266 m8 hsa-miR-374 UUAUAAUACAACCUGAUAAGUG
miR-380-5p 348 354 m8 hsa-miR-380-5p UGGUUGACCAUAGAACAUGCGC
hsa-miR-563 AGGUUGACAUACGUUUCCC
miR-410 262 268 1A hsa-miR-410 AAUAUAACACAGAUGGCCUGU