Gene Page:KCNK3

Summary?
GeneID 3777
Symbol KCNK3
Synonyms K2p3.1|OAT1|PPH4|TASK|TASK-1|TBAK1
Description potassium two pore domain channel subfamily K member 3
Reference MIM:603220|HGNC:HGNC:6278|HPRD: 04451|
Gene type protein-coding
Map location 2p23
Pascal p-value 0.001
Sherlock p-value 0.618
Fetal beta -1.431

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005244 voltage-gated ion channel activity IEA -
GO:0005267 potassium channel activity TAS 9312005
GO:0030955 potassium ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007268 synaptic transmission TAS neuron, Synap, Neurotransmitter (GO term level: 6) 9312005
GO:0006811 ion transport IEA -
GO:0006813 potassium ion transport TAS 9312005
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0005887 integral to plasma membrane TAS 9312005

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME NEURONAL SYSTEM 279 221 All SZGR 2.0 genes in this pathway
REACTOME TANDEM PORE DOMAIN POTASSIUM CHANNELS 12 7 All SZGR 2.0 genes in this pathway
REACTOME POTASSIUM CHANNELS 98 68 All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN 634 384 All SZGR 2.0 genes in this pathway
WILCOX RESPONSE TO PROGESTERONE DN 66 44 All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN 384 230 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK DN 196 131 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP 197 135 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355 243 All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS 205 145 All SZGR 2.0 genes in this pathway
ROPERO HDAC2 TARGETS 114 71 All SZGR 2.0 genes in this pathway
WEI MIR34A TARGETS 148 97 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP 249 170 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN 504 323 All SZGR 2.0 genes in this pathway
ZHENG RESPONSE TO ARSENITE UP 18 14 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN 546 362 All SZGR 2.0 genes in this pathway
NUTT GBM VS AO GLIOMA DN 45 22 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349 234 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341 243 All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP 279 155 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-23 225 232 1A,m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-323 225 231 1A hsa-miR-323brain GCACAUUACACGGUCGACCUCU