Gene Page:KCNN2

Summary?
GeneID 3781
Symbol KCNN2
Synonyms KCa2.2|SK2|SKCA2|SKCa 2|hSK2
Description potassium calcium-activated channel subfamily N member 2
Reference MIM:605879|HGNC:HGNC:6291|运用:ENSG00000080709|HPRD:09323|Vega:OTTHUMG00000128836
Gene type protein-coding
Map location 5q22.3
Pascal p-value 0.377
Fetal beta -0.968
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 3

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg01939336 5 113697487 KCNN2 3.04E-9 -0.012 2.09E-6 DMG:Jaffe_2016
cg23615676 5 113697632 KCNN2 3.82E-8 -0.009 1.09E-5 DMG:Jaffe_2016
cg24830738 5 113698445 KCNN2 4.27E-8 -0.01 1.18E-5 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005516 calmodulin binding IEA -
GO:0005216 ion channel activity IEA -
GO:0016286 small conductance calcium-activated potassium channel activity TAS 10991935
GO:0015269 calcium-activated potassium channel activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006811 ion transport IEA -
GO:0006813 potassium ion transport IEA -
GO:0006813 potassium ion transport NAS 10991935
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0016021 integral to membrane NAS 10991935

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME NEURONAL SYSTEM 279 221 All SZGR 2.0 genes in this pathway
REACTOME POTASSIUM CHANNELS 98 68 All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP 146 99 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS 290 172 All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734 436 All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS 179 105 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
HELLER SILENCED BY METHYLATION UP 282 183 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP 461 298 All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN 546 362 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 16 26 17 All SZGR 2.0 genes in this pathway
SETLUR PROSTATE CANCER TMPRSS2 ERG FUSION UP 67 48 All SZGR 2.0 genes in this pathway
国外RB1增长目标 243 155 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
OHGUCHI LIVER HNF4A TARGETS DN 149 85 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-140 14 20 1A hsa-miR-140brain AGUGGUUUUACCCUAUGGUAG