Gene Page:ARF6

Summary?
GeneID 382
Symbol ARF6
Synonyms -
Description ADP ribosylation factor 6
Reference MIM:600464|HGNC:HGNC:659|Ensembl:ENSG00000165527|HPRD:02714|Vega:OTTHUMG00000140296
Gene type protein-coding
Map location 14q21.3
Pascal p-value 0.627
Fetal beta -0.064
eGene Cerebellar Hemisphere
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0192

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs11682393 chr2 47804496 ARF6 382 0.1 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC:分皮质区域;SM:感觉运动区域s; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0003924 GTPase activity TAS 1993656
GO:0005515 protein binding IPI 9312003
GO:0005525 GTP binding TAS 10913182
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0001889 liver development IEA -
GO:0007155 cell adhesion TAS 10036235
GO:0006928 cell motion TAS 10036235
GO:0007264 small GTPase mediated signal transduction IEA -
GO:0006915 apoptosis IEA -
GO:0016192 vesicle-mediated transport TAS 10913182
GO:0035020 regulation of Rac protein signal transduction IDA 10036235
GO:0015031 protein transport IEA -
GO:0031529 ruffle organization IDA 10036235
GO:0048261 negative regulation of receptor-mediated endocytosis TAS 9312003
GO:0030838 positive regulation of actin filament polymerization IMP 10036235
GO:0030866 cortical actin cytoskeleton organization IMP 10913182
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0001726 ruffle IDA 9312003
GO:0005794 Golgi apparatus IEA -
GO:0005622 intracellular IEA -
GO:0005624 membrane fraction TAS 8702973
GO:0005737 cytoplasm IEA -
GO:0005768 endosome TAS 10913182
GO:0005938 cell cortex IDA 10913182
GO:0005886 plasma membrane IDA 10036235

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
AP1B1 ADTB1 | AP105A | BAM22 | CLAPB2 adaptor-related protein complex 1, beta 1 subunit - HPRD 11926829
AP3B1 ADTB3 | ADTB3A | HPS | HPS2 | PE adaptor-related protein complex 3, beta 1 subunit Reconstituted Complex BioGRID 11926829
AP3D1 ADTD | hBLVR adaptor-related protein complex 3, delta 1 subunit - HPRD 11926829
AP3S2 AP3S3 | FLJ35955 | sigma3b adaptor-related protein complex 3, sigma 2 subunit Reconstituted Complex BioGRID 11926829
ARFIP2 POR1 ADP-ribosylation factor interacting protein 2 - HPRD,BioGRID 9312003
ARRB1 ARB1 | ARR1 arrestin, beta 1 - HPRD,BioGRID 11533043|11867621
ARRB2 ARB2 | ARR2 | BARR2 | DKFZp686L0365 arrestin, beta 2 - HPRD,BioGRID 11533043|11867621
ASAP2 AMAP2 | CENTB3 | DDEF2 | FLJ42910 | KIAA0400 | PAG3 | PAP | Pap-alpha | SHAG1 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 - HPRD 10022920|10749932
CHRM3 HM3 cholinergic receptor, muscarinic 3 - HPRD,BioGRID 12799371
CYTH2 ARNO | CTS18 | CTS18.1 | PSCD2 | PSCD2L | SEC7L | Sec7p-L | Sec7p-like cytohesin 2 - HPRD,BioGRID 9417041
DHPS MIG13 deoxyhypusine synthase Affinity Capture-MS BioGRID 17353931
DYNC1H1 DHC1 | DHC1a | DKFZp686P2245 | DNCH1 | DNCL | DNECL | DYHC | Dnchc1 | HL-3 | KIAA0325 | p22 dynein, cytoplasmic 1, heavy chain 1 Affinity Capture-MS BioGRID 17353931
EIF6 2 | CAB | EIF3A | ITGB4BP | b | b(2)gcn | gcn | p27BBP eukaryotic translation initiation factor 6 Affinity Capture-MS BioGRID 17353931
EPPK1 EPIPL | EPIPL1 epiplakin 1 Affinity Capture-MS BioGRID 17353931
EXOC5 DKFZp666H126 | HSEC10 | PRO1912 | SEC10 | SEC10L1 | SEC10P exocyst complex component 5 - HPRD,BioGRID 14662749
GART AIRS | GARS | GARTF | MGC47764 | PAIS | PGFT | PRGS phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase Affinity Capture-MS BioGRID 17353931
IQGAP1 HUMORFA01 | KIAA0051 | SAR1 | p195 IQ motif containing GTPase activating protein 1 Affinity Capture-MS BioGRID 17353931
KIAA0368 ECM29 | FLJ22036 | KIAA1962 | RP11-386D8.2 KIAA0368 Affinity Capture-MS BioGRID 17353931
LRPPRC CLONE-23970 | GP130 | LRP130 | LSFC leucine-rich PPR-motif containing Affinity Capture-MS BioGRID 17353931
PABPC4 APP-1 | APP1 | FLJ43938 | PABP4 | iPABP 保利(A)结合蛋白、胞质4(诱导form) Affinity Capture-MS BioGRID 17353931
PIP5K1A - phosphatidylinositol-4-phosphate 5-kinase, type I, alpha - HPRD 10589680
PIP5K1C KIAA0589 | LCCS3 | PIP5K-GAMMA | PIP5Kgamma phosphatidylinositol-4-phosphate 5-kinase, type I, gamma - HPRD,BioGRID 12847086
PLD1 - phospholipase D1, phosphatidylcholine-specific - HPRD,BioGRID 12379803
RAB11FIP3 KIAA0665 | Rab11-FIP3 RAB11 family interacting protein 3 (class II) - HPRD 11535061
RALA MGC48949 | RAL v-ral simian leukemia viral oncogene homolog A (ras related) Affinity Capture-Western BioGRID 12509462
YARS CMTDIC | TYRRS | YRS | YTS tyrosyl-tRNA synthetase Affinity Capture-MS BioGRID 17353931


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ENDOCYTOSIS 183 132 All SZGR 2.0 genes in this pathway
KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS 97 71 All SZGR 2.0 genes in this pathway
PID MET PATHWAY 80 60 All SZGR 2.0 genes in this pathway
PID ARF6 TRAFFICKING PATHWAY 49 34 All SZGR 2.0 genes in this pathway
PID ARF6 PATHWAY 35 27 All SZGR 2.0 genes in this pathway
PID ARF6 DOWNSTREAM PATHWAY 15 14 All SZGR 2.0 genes in this pathway
PID PI3KCI PATHWAY 49 40 All SZGR 2.0 genes in this pathway
PID AJDISS 2PATHWAY 48 38 All SZGR 2.0 genes in this pathway
PID ECADHERIN NASCENT AJ PATHWAY 39 33 All SZGR 2.0 genes in this pathway
PID ECADHERIN STABILIZATION PATHWAY 42 34 All SZGR 2.0 genes in this pathway
PID INTEGRIN A4B1 PATHWAY 33 24 All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP 423 283 All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS DN 310 188 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN 770 415 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM1 229 137 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
SCIAN INVERSED TARGETS OF TP53 AND TP73 DN 31 23 All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 240 HELA 60 43 All SZGR 2.0 genes in this pathway
SUNG METASTASIS STROMA DN 54 34 All SZGR 2.0 genes in this pathway
GOLDRATH HOMEOSTATIC PROLIFERATION 171 102 All SZGR 2.0 genes in this pathway
CHEOK RESPONSE TO HD MTX DN 24 18 All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT REJECTED VS OK UP 63 48 All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP 555 346 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
LEI MYB TARGETS 318 215 All SZGR 2.0 genes in this pathway
XU CREBBP TARGETS DN 44 31 All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D4 55 37 All SZGR 2.0 genes in this pathway
JI RESPONSE TO FSH DN 58 43 All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN 312 203 All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP 100 72 All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS UP 198 132 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
HILLION HMGA1B TARGETS 92 68 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP 439 257 All SZGR 2.0 genes in this pathway
LABBE TARGETS OF TGFB1 AND WNT3A DN 108 68 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP 491 316 All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS FIBROBLAST UP 84 60 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP 518 299 All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION 422 277 All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER UP 307 182 All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 3 DN 42 24 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN 553 343 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP 344 215 All SZGR 2.0 genes in this pathway
HOLLEMAN ASPARAGINASE RESISTANCE B ALL DN 15 10 All SZGR 2.0 genes in this pathway
HOLLEMAN ASPARAGINASE RESISTANCE ALL DN 25 14 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-139 425 431 1A hsa-miR-139brain UCUACAGUGCACGUGUCU
miR-23 577 583 m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-30-3p 485 492 1A,m8 hsa-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC
miR-323 577 583 1A hsa-miR-323brain GCACAUUACACGGUCGACCUCU
miR-494 470 476 1A hsa-miR-494brain UGAAACAUACACGGGAAACCUCUU