Gene Page:ARG1

Summary?
GeneID 383
Symbol ARG1
Synonyms -
Description arginase 1
Reference MIM:608313|HGNC:HGNC:663|Ensembl:ENSG00000118520|HPRD:01947|Vega:OTTHUMG00000015566
Gene type protein-coding
Map location 6q23
Pascal p-value 0.106
Fetal beta -0.374
DMG 1 (# studies)
eGene 元

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:vanEijk_2014 Genome-wide DNA methylation analysis This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg17026542 6 132022490 ARG1 0.007 5.4 DMG:vanEijk_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004053 arginase activity TAS 3540966
GO:0016787 hydrolase activity IEA -
GO:0030145 manganese ion binding IEA -
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0000050 urea cycle IEA -
GO:0006527 arginine catabolic process TAS 3540966
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm TAS 3540966

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ARGININE AND PROLINE METABOLISM 54 39 All SZGR 2.0 genes in this pathway
PID IL4 2PATHWAY 65 43 All SZGR 2.0 genes in this pathway
PID ATF2 PATHWAY 59 43 All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF AMINO ACIDS AND DERIVATIVES 200 136 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D DN 143 83 All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN 226 132 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN 508 354 All SZGR 2.0 genes in this pathway
DARWICHE皮肤肿瘤促进剂DN 185 115 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW UP 162 104 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH UP 147 101 All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA UP 146 104 All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO UP 205 126 All SZGR 2.0 genes in this pathway
HSIAO LIVER SPECIFIC GENES 244 154 All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP 412 249 All SZGR 2.0 genes in this pathway
TAVOR CEBPA TARGETS UP 48 36 All SZGR 2.0 genes in this pathway
SU LIVER 55 32 All SZGR 2.0 genes in this pathway
KEEN RESPONSE TO ROSIGLITAZONE DN 106 68 All SZGR 2.0 genes in this pathway
COATES MACROPHAGE M1 VS M2 DN 78 44 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN UP 181 112 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN 540 340 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN 274 165 All SZGR 2.0 genes in this pathway
ZHENG IL22 SIGNALING UP 56 36 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN 366 257 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP 491 316 All SZGR 2.0 genes in this pathway
LIU VAV3 PROSTATE CARCINOGENESIS UP 89 61 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S3 266 180 All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT DN 222 141 All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS UP 61 41 All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR UP 199 143 All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462 273 All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP 289 184 All SZGR 2.0 genes in this pathway
HECKER IFNB1 TARGETS 95 54 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-142-5p 409 415 1A hsa-miR-142-5p CAUAAAGUAGAAAGCACUAC