Gene Page:NOTCH2NL

Summary?
GeneID 388677
Symbol NOTCH2NL
Synonyms N2N
Description notch 2 N-terminal like
Reference HGNC:HGNC:31862|HPRD:14833|
Gene type protein-coding
Map location 1q21.2
Sherlock p-value 0.957
Fetal beta -0.578
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CNV:YES Copy number variation studies Manual curation
GSMA_I Genome scan meta-analysis Psr: 0.0235
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00814

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16853024 chr2 167998441 NOTCH2NL 388677 0.18 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005509 calcium ion binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007219 Notch signaling pathway IEA -
GO:0007275 multicellular organismal development IEA -
GO:0030154 cell differentiation IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN 634 384 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP 783 507 All SZGR 2.0 genes in this pathway
WILCOX RESPONSE TO PROGESTERONE DN 66 44 All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN 463 290 All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL 326 213 All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP 414 287 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769 437 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES DN 245 144 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP 260 174 All SZGR 2.0 genes in this pathway
SHEDDEN肺癌好生存A4 196 124 All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G1 UP 113 70 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 DN 45 30 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS UP 221 120 All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN 418 245 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-30-3p 505 511 1A hsa-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC