Gene Page:TMEM200B

Summary?
GeneID 399474
Symbol TMEM200B
Synonyms TTMB
Description transmembrane protein 200B
Reference HGNC:HGNC:33785|Ensembl:ENSG00000253304|HPRD:13188|Vega:OTTHUMG00000003658
Gene type protein-coding
Map location 1p35
Pascal p-value 8.363E-4
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs368407 chr1 30439987 TMEM200B 399474 0.12 cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
LIU PROSTATE CANCER DN 481 290 All SZGR 2.0 genes in this pathway
LIAO METASTASIS 539 324 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE 246 153 All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C 463 262 All SZGR 2.0 genes in this pathway
国外RB1目标CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS DN 115 73 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN 918 550 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-142-3p 928 935 1A,m8 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
miR-26 1054 1060 m8 hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU
miR-28 1092 1098 m8 hsa-miR-28brain AAGGAGCUCACAGUCUAUUGAG
miR-34/449 573 579 1A hsa-miR-34abrain UGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449 UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
miR-431 906 912 m8 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
miR-496 1043 1049 1A hsa-miR-496 AUUACAUGGCCAAUCUC