Gene Page:LRP1恰巧

Summary?
GeneID 4035
Symbol LRP1恰巧
Synonyms A2MR|APOER|APR|CD91|IGFBP3R|LRP|LRP1A|TGFBR5
Description LDL receptor related protein 1
Reference MIM:107770|HGNC:HGNC:6692|Ensembl:ENSG00000123384|HPRD:00138|Vega:OTTHUMG00000044412
Gene type protein-coding
Map location 12q13.3
Pascal p-value 6.808E-4
Sherlock p-value 0.991
TADA p-value 0.008
Fetal beta 1.604
Support CELL METABOLISM
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DNM:Girard_2011 Whole Exome Sequencing analysis The data set included 15 DNMs found from the exomes of 14 schizophrenia probands and their parents.
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search 与精神分裂症Co-occurance关键词:schizophrenia,schizophrenic,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 1.7051

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
LRP1恰巧 chr12 57579450 C A NM_002332 p.2200Y>* nonsense Schizophrenia DNM:Girard_2011


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
COL3A1 0.90 0.64
OLFML3 0.87 0.73
C7 0.86 0.73
BMP5 0.86 0.59
ASPN 0.85 0.74
OGN 0.82 0.78
PCOLCE 0.81 0.48
AL137026.3 0.81 0.54
SERPIND1 0.80 0.59
COL1A2 0.80 0.67
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.33 -0.25 -0.19
ACADVL -0.24 -0.27
AF347015.26 -0.24 -0.19
S100A1 -0.24 -0.12
AF347015.8 -0.24 -0.19
MT-CO2 -0.24 -0.18
AF347015.2 -0.24 -0.20
AF347015.27 -0.24 -0.17
AF347015.15 -0.23 -0.17
AC018755.7 -0.23 -0.15

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004872 receptor activity TAS 10880251
GO:0005509 calcium ion binding IEA -
GO:0005509 calcium ion binding TAS 3266596
GO:0005319 lipid transporter activity TAS 3266596
GO:0008034 lipoprotein binding TAS 2779654
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0008283 cell proliferation TAS 3266596
GO:0006629 lipid metabolic process TAS 3266596
GO:0006897 endocytosis IEA -
GO:0007275 multicellular organismal development IEA -
GO:0030178 negative regulation of Wnt receptor signaling pathway IEA -
GO:0043277 apoptotic cell clearance IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005624 membrane fraction TAS 2779654
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -
GO:0005905 coated pit IEA -
GO:0005886 plasma membrane IEA -
GO:0005887 integral to plasma membrane TAS 3266596

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
A2M CPAMD5 | DKFZp779B086 | FWP007 | S863-7 alpha-2-macroglobulin - HPRD,BioGRID 10652313
ANAPC10 APC10 | DKFZp564L0562 | DOC1 anaphase promoting complex subunit 10 - HPRD,BioGRID 10827173
APBA2 D15S1518E | HsT16821 | LIN-10 | MGC99508 | MGC:14091 | MINT2 | X11L amyloid beta (A4) precursor protein-binding, family A, member 2 Two-hybrid BioGRID 10827173
APBB1 FE65 | MGC:9072 | RIR amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) - HPRD,BioGRID 9837937
APOE AD2 | LPG | MGC1571 | apoprotein apolipoprotein E - HPRD 11421580
APP AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 amyloid beta (A4) precursor protein - HPRD 7543026|12212791
C3 ARMD9 | ASP | CPAMD1 complement component 3 - HPRD 10608878
C4BPA C4BP | PRP complement component 4 binding protein, alpha - HPRD 11705989
CALCR CRT | CTR | CTR1 calcitonin receptor Affinity Capture-Western
Reconstituted Complex		 BioGRID 12821648
CALR CRT | FLJ26680 | RO | SSA | cC1qR calreticulin - HPRD,BioGRID 12821648|14980518
CANX CNX | FLJ26570 | IP90 | P90 calnexin - HPRD,BioGRID 14980518
CD82 4F9 | C33 | GR15 | IA4 | KAI1 | R2 | SAR2 | ST6 | TSPAN27 CD82 molecule - HPRD 9804823
CTGF CCN2 | HCS24 | IGFBP8 | MGC102839 | NOV2 connective tissue growth factor - HPRD 14585398
CTSG CG | MGC23078 cathepsin G LRP interacts with Cathepsin G. BIND 15131125
DAB1 - disabled homolog 1 (Drosophila) - HPRD,BioGRID 10827173
DAB2 DOC-2 | DOC2 | FLJ26626 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) Reconstituted Complex BioGRID 11247302
DLG4 FLJ97752 | FLJ98574 | PSD95 | SAP90 discs, large homolog 4 (Drosophila) - HPRD,BioGRID 10827173
ELA2 GE | HLE | HNE | NE | PMN-E elastase 2, neutrophil LRP interacts with Elastase 2. BIND 15131125
F8 AHF | DXS1253E | F8B | F8C | FVIII | HEMA coagulation factor VIII, procoagulant component - HPRD,BioGRID 12522143
F9 FIX | HEMB | MGC129641 | MGC129642 | PTC coagulation factor IX - HPRD,BioGRID 12522212
FURIN FUR | PACE | PCSK3 | SPC1 furin (paired basic amino acid cleaving enzyme) - HPRD 8546712
GIPC1 C19orf3 | GIPC | GLUT1CBP | Hs.6454 | IIP-1 | MGC15889 | MGC3774 | NIP | RGS19IP1 | SEMCAP | SYNECTIIN | SYNECTIN | TIP-2 GIPC PDZ domain containing family, member 1 Reconstituted Complex
Two-hybrid		 BioGRID 10827173
GTPBP1 GP-1 | GP1 | HSPC018 | MGC20069 GTP binding protein 1 - HPRD 9820815
GULP1 CED-6 | CED6 | FLJ31156 | GULP GULP, engulfment adaptor PTB domain containing 1 - HPRD,BioGRID 11729193
HSP90B1 ECGP | GP96 | GRP94 | TRA1 heat shock protein 90kDa beta (Grp94), member 1 - HPRD 11861214
ITGB1BP1 DKFZp686K08158 | ICAP-1A | ICAP-1B | ICAP-1alpha | ICAP1 | ICAP1A | ICAP1B integrin beta 1 binding protein 1 - HPRD,BioGRID 10827173
KAT5 ESA1 | HTATIP | HTATIP1 | PLIP | TIP | TIP60 | cPLA2 K(lysine) acetyltransferase 5 - HPRD,BioGRID 12888553
LIPC HDLCQ12 | HL | HTGL | LIPH lipase, hepatic - HPRD,BioGRID 7721852
LPL HDLCQ11 | LIPD lipoprotein lipase - HPRD 1281473|7510694|7989348
LPL HDLCQ11 | LIPD lipoprotein lipase Reconstituted Complex BioGRID 1281473|7510694
|7989348
LRPAP1 A2MRAP | A2RAP | HBP44 | MGC138272 | MRAP | RAP low density lipoprotein receptor-related protein associated protein 1 - HPRD,BioGRID 1374383|1718973
|10747918
LTF GIG12 | HLF2 | LF lactotransferrin - HPRD 1464627
MAPK8IP1 IB1 | JIP-1 | JIP1 | PRKM8IP mitogen-activated protein kinase 8 interacting protein 1 - HPRD,BioGRID 10827173
MAPK8IP2 IB2 | JIP2 | PRKM8IPL mitogen-activated protein kinase 8 interacting protein 2 Reconstituted Complex
Two-hybrid		 BioGRID 10827173
MDK FLJ27379 | MK | NEGF2 midkine (neurite growth-promoting factor 2) - HPRD,BioGRID 10772929
MMP13 CLG3 matrix metallopeptidase 13 (collagenase 3) - HPRD 10514495
MMP14 MMP-X1 | MT1-MMP | MTMMP1 matrix metallopeptidase 14 (membrane-inserted) - HPRD,BioGRID 14645246
MMP15 MT2-MMP | MTMMP2 | SMCP-2 matrix metallopeptidase 15 (membrane-inserted) - HPRD 14645246
MMP16 MMP-X2 | MT-MMP2 | MT-MMP3 | MT3-MMP matrix metallopeptidase 16 (membrane-inserted) - HPRD 14645246
MMP17 MT4-MMP matrix metallopeptidase 17 (membrane-inserted) - HPRD 14645246
NOS1AP 6330408P19Rik | CAPON | MGC138500 nitric oxide synthase 1 (neuronal) adaptor protein - HPRD,BioGRID 10827173
PDGFB FLJ12858 | PDGF2 | SIS | SSV | c-sis platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) - HPRD,BioGRID 11854294
PDIA2 PDA2 | PDI | PDIP | PDIR protein disulfide isomerase family A, member 2 Affinity Capture-Western BioGRID 14980518
PLAT DKFZp686I03148 | T-PA | TPA plasminogen activator, tissue - HPRD,BioGRID 1502153|10632583
PLAUR CD87 | UPAR | URKR plasminogen activator, urokinase receptor - HPRD,BioGRID 11359936
SCN3A KIAA1356 | NAC3 | Nav1.3 sodium channel, voltage-gated, type III, alpha subunit Two-hybrid BioGRID 10827173
SERPINA1 A1A | A1AT | AAT | MGC23330 | MGC9222 | PI | PI1 | PRO2275 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 LRP interacts with alpha-1-PI. BIND 15131125
SERPINA3 AACT | ACT | GIG24 | GIG25 | MGC88254 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 LRP interacts with alpha-1-ACT. BIND 15131125
SERPINE1 PAI | PAI-1 | PAI1 | PLANH1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 - HPRD,BioGRID 15001579
SHC1 FLJ26504 | SHC | SHCA SHC (Src homology 2 domain containing) transforming protein 1 Affinity Capture-Western
Reconstituted Complex		 BioGRID 11854294|12789267
SHC1 FLJ26504 | SHC | SHCA SHC (Src homology 2 domain containing) transforming protein 1 - HPRD 12069755|12789267
SNX17 KIAA0064 sorting nexin 17 Reconstituted Complex BioGRID 12169628
SRC ASV | SRC1 | c-SRC | p60-Src v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) Biochemical Activity BioGRID 11854294
SYNJ2BP ARIP2 | FLJ11271 | FLJ41973 | OMP25 synaptojanin 2 binding protein - HPRD,BioGRID 10827173
THBS1 THBS | TSP | TSP1 thrombospondin 1 - HPRD,BioGRID 9045712|14991768


部分诉路径way annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ALZHEIMERS DISEASE 169 110 All SZGR 2.0 genes in this pathway
ST WNT BETA CATENIN PATHWAY 34 28 All SZGR 2.0 genes in this pathway
PID AMB2 NEUTROPHILS PATHWAY 41 32 All SZGR 2.0 genes in this pathway
PID UPA UPAR PATHWAY 42 30 All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY 129 103 All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP 783 507 All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN 712 443 All SZGR 2.0 genes in this pathway
JOHANSSON BRAIN CANCER EARLY VS LATE DN 45 35 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514 330 All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP 398 262 All SZGR 2.0 genes in this pathway
NADLER OBESITY UP 61 34 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN 366 238 All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN 408 274 All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER HEREDITARY VS SPORADIC 50 32 All SZGR 2.0 genes in this pathway
CHANG IMMORTALIZED BY HPV31 DN 65 45 All SZGR 2.0 genes in this pathway
JIANG VHL TARGETS 138 91 All SZGR 2.0 genes in this pathway
VERRECCHIA RESPONSE TO TGFB1 C2 25 18 All SZGR 2.0 genes in this pathway
VERRECCHIA EARLY RESPONSE TO TGFB1 58 43 All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE UP 95 64 All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL 311 205 All SZGR 2.0 genes in this pathway
ABE INNER EAR 48 26 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY 4NQO OR UV 63 44 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP 226 164 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER ERBB2 UP 147 83 All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS 425 261 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP 260 174 All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN 546 362 All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP 245 159 All SZGR 2.0 genes in this pathway
WINTER HYPOXIA METAGENE 242 168 All SZGR 2.0 genes in this pathway
HELLEBREKERS SILENCED DURING TUMOR ANGIOGENESIS 80 56 All SZGR 2.0 genes in this pathway
MIZUKAMI HYPOXIA DN 6 5 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP 293 203 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN 457 302 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN 668 419 All SZGR 2.0 genes in this pathway
COULOUARN TEMPORAL TGFB1 SIGNATURE DN 138 99 All SZGR 2.0 genes in this pathway
SETLUR PROSTATE CANCER TMPRSS2 ERG FUSION UP 67 48 All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT DN 222 141 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718 401 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3 445 257 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP 430 288 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549 316 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE 317 190 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745 475 All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF 367 231 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-103/107 213 219 m8 hsa-miR-103brain AGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brain AGCAGCAUUGUACAGGGCUAUCA
miR-200bc/429 167 174 1A,m8 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
miR-205 118 125 1A,m8 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
miR-369-3p 169 175 m8 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
miR-496 110 116 1A hsa-miR-496 AUUACAUGGCCAAUCUC