Gene Page:CAPRIN1

Summary?
GeneID 4076
Symbol CAPRIN1
Synonyms GPIAP1|GPIP137|GRIP137|M11S1|RNG105|p137GPI
Description cell cycle associated protein 1
Reference MIM:601178|HGNC:HGNC:6743|Ensembl:ENSG00000135387|HPRD:03108|Vega:OTTHUMG00000166248
Gene type protein-coding
Map location 11p13
Pascal p-value 0.001
Sherlock p-value 0.721
Fetal beta 1.461
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
PMID:cooccur High-throughput literature-search 系统搜索PubMed genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations 支安打与neuro-related关键词:1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg26801843 11 34073061 CAPRIN1 1.64E-9 -0.011 1.47E-6 DMG:Jaffe_2016
cg05533552 11 34074141 CAPRIN1 4.22E-8 -0.021 1.17E-5 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0042995 cell projection IEA axon (GO term level: 4) -
GO:0005737 cytoplasm IEA -
GO:0005887 integral to plasma membrane TAS 7657653

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ONKEN UVEAL MELANOMA DN 526 357 All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA UP 294 178 All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP 423 283 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP 457 269 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375 806 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP 722 443 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN 770 415 All SZGR 2.0 genes in this pathway
SEIDEN MET SIGNALING 19 16 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514 330 All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734 436 All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN 309 206 All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN 337 230 All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION UP 87 67 All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C1 72 45 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS UP 425 253 All SZGR 2.0 genes in this pathway
TOOKER GEMCITABINE RESISTANCE DN 122 84 All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G123 UP 45 21 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP 605 377 All SZGR 2.0 genes in this pathway
GREGORY SYNTHETIC LETHAL WITH IMATINIB 145 83 All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS 289 187 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP 430 288 All SZGR 2.0 genes in this pathway
MIKHAYLOVA OXIDATIVE STRESS RESPONSE VIA VHL UP 7 6 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN 553 343 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658 397 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-1/206 1699 1706 1A,m8 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZ UGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
miR-136 1491 1497 1A hsa-miR-136 ACUCCAUUUGUUUUGAUGAUGGA
miR-145 1648 1654 m8 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCUU
miR-19 229 235 1A hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
miR-193 41 47 m8 hsa-miR-193a AACUGGCCUACAAAGUCCCAG
hsa-miR-193b AACUGGCCCUCAAAGUCCCGCUUU
miR-199 36 42 m8 hsa-miR-199a CCCAGUGUUCAGACUACCUGUUC
hsa-miR-199b CCCAGUGUUUAGACUAUCUGUUC
miR-204/211 112 118 m8 hsa-miR-204brain UUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
miR-330 671 677 1A hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-378 96 102 1A hsa-miR-378 CUCCUGACUCCAGGUCCUGUGU
miR-409-3p 1706 1712 1A hsa-miR-409-3p CGAAUGUUGCUCGGUGAACCCCU
miR-496 611 618 1A,m8 hsa-miR-496 AUUACAUGGCCAAUCUC