Gene Page:MAB21L1

Summary?
GeneID 4081
Symbol MAB21L1
Synonyms CAGR1|Nbla00126
Description mab-21-like 1 (C. elegans)
Reference MIM:601280|HGNC:HGNC:6757|HPRD:03178|
Gene type protein-coding
Map location 13q13
Fetal beta 0.848
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16829545 chr2 151977407 MAB21L1 4081 2.435E-21 trans
rs3845734 chr2 171125572 MAB21L1 4081 0.07 trans
rs7584986 chr2 184111432 MAB21L1 4081 8.99E-11 trans
rs6741060 chr2 217169088 MAB21L1 4081 0.15 trans
rs9810143 chr3 5060209 MAB21L1 4081 0.12 trans
rs2183142 chr4 159232695 MAB21L1 4081 6.661E-4 trans
rs170776 chr4 173276735 MAB21L1 4081 0.01 trans
rs1396222 chr4 173279496 MAB21L1 4081 0 trans
rs335993 chr4 173321789 MAB21L1 4081 0 trans
rs335980 chr4 173329784 MAB21L1 4081 0.01 trans
rs335982 chr4 173330945 MAB21L1 4081 0.06 trans
rs337984 chr4 173411662 MAB21L1 4081 0.04 trans
rs10491487 chr5 80323367 MAB21L1 4081 5.758E-5 trans
rs13191953 chr6 24151042 MAB21L1 4081 0.15 trans
rs12196880 chr6 24313746 MAB21L1 4081 0.17 trans
rs10806988 chr6 24341768 MAB21L1 4081 0.11 trans
rs9461864 chr6 33481468 MAB21L1 4081 0.03 trans
rs16890367 chr6 38078448 MAB21L1 4081 0.03 trans
rs1869293 chr7 158181108 MAB21L1 4081 0.18 trans
rs9638062 chr7 158221572 MAB21L1 4081 0.18 trans
rs6996695 chr8 77540580 MAB21L1 4081 0 trans
rs3118341 chr9 25185518 MAB21L1 4081 0.06 trans
rs1126130 chr9 25209346 MAB21L1 4081 0.15 trans
rs1998746 chr9 25211761 MAB21L1 4081 0.15 trans
rs1332433 chr9 25214440 MAB21L1 4081 0.2 trans
rs9406868 chr9 25223372 MAB21L1 4081 9.325E-4 trans
rs11139334 chr9 84209393 MAB21L1 4081 3.186E-4 trans
rs4837782 chr9 123330812 MAB21L1 4081 0.15 trans
rs17143839 chr10 8520836 MAB21L1 4081 0.12 trans
rs12098525 chr10 87501764 MAB21L1 4081 0.17 trans
rs4122086 chr11 92430845 MAB21L1 4081 0.11 trans
rs10501795 chr11 92447417 MAB21L1 4081 0.11 trans
rs10501796 chr11 92453155 MAB21L1 4081 0.11 trans
rs9989228 chr14 37809252 MAB21L1 4081 0.09 trans
rs16955618 chr15 29937543 MAB21L1 4081 1.143E-23 trans
rs2077735 chr15 58479024 MAB21L1 4081 0.04 trans
rs9941296 chr16 2759498 MAB21L1 4081 0.01 trans
rs16945437 chr17 11797650 MAB21L1 4081 0.04 trans
rs11873184 chr18 1584081 MAB21L1 4081 0.13 trans
rs11882889 chr19 19887684 MAB21L1 4081 0.11 trans
rs1041786 chr21 22617710 MAB21L1 4081 0.01 trans
rs16981387 chr22 26495864 MAB21L1 4081 0.15 trans
rs16986332 chrX 10958354 MAB21L1 4081 0.03 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0008284 positive regulation of cell proliferation IEA -
GO:0009653 anatomical structure morphogenesis TAS 8733127
GO:0007275 multicellular organismal development IEA -
GO:0043010 camera-type eye development IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ZHOU INFLAMMATORY RESPONSE LIVE UP 485 293 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR DN 129 84 All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN DN 172 112 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
RORIE TARGETS OF EWSR1 FLI1 FUSION DN 30 23 All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA UP 98 64 All SZGR 2.0 genes in this pathway
TRAYNOR RETT SYNDROM DN 19 14 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN 120 81 All SZGR 2.0 genes in this pathway
阿塞维多了HYLATED IN LIVER CANCER DN 940 425 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED 536 296 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 2HR DN 49 33 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL 162 122 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM A 182 108 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-1/206 655 662 1A,m8 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZ UGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
miR-143 144 151 1A,m8 hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
miR-199 770 777 1A,m8 hsa-miR-199a CCCAGUGUUCAGACUACCUGUUC
hsa-miR-199b CCCAGUGUUUAGACUAUCUGUUC
miR-26 669 676 1A,m8 hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU
hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU
miR-30-5p 616 622 1A hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrain UGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZ UGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZ UGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGA
miR-363 93 99 1A hsa-miR-363 AUUGCACGGUAUCCAUCUGUAA
miR-409-3p 654 660 m8 hsa-miR-409-3p CGAAUGUUGCUCGGUGAACCCCU
miR-410 742 748 1A hsa-miR-410 AAUAUAACACAGAUGGCCUGU
hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-452 94 101 1A,m8 hsa-miR-452 UGUUUGCAGAGGAAACUGAGAC
miR-543 676 682 1A hsa-miR-543 AAACAUUCGCGGUGCACUUCU