Gene Page:SMAD4

Summary?
GeneID 4089
Symbol SMAD4
Synonyms DPC4|JIP|MADH4|MYHRS
Description SMAD家庭成员4
Reference MIM:600993|HGNC:HGNC:6770|Ensembl:ENSG00000141646|HPRD:02995|Vega:OTTHUMG00000132696
Gene type protein-coding
Map location 18q21.1
Pascal p-value 0.201
Sherlock p-value 0.119
Fetal beta 1.113
DMG 2 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 4
DMG:Nishioka_2013 Genome-wide DNA methylation analysis The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 4
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0482

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg10315128 18 48556631 SMAD4 -0.021 0.35 DMG:Nishioka_2013
cg27644254 18 48556578 SMAD4 4.17E-8 -0.008 1.16E-5 DMG:Jaffe_2016
cg23885062 18 48556580 SMAD4 8.29E-8 -0.008 1.93E-5 DMG:Jaffe_2016
cg10315128 18 48556631 SMAD4 9.67E-8 -0.006 2.16E-5 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity IEA -
GO:0016563 transcription activator activity IEA -
GO:0042803 protein homodimerization activity 新闻学会 8774881
GO:0043565 sequence-specific DNA binding IDA 10823886
GO:0046332 SMAD binding 新闻学会 8774881
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0001666 response to hypoxia IMP 12411310
GO:0001658 ureteric bud branching IEA -
GO:0001702 gastrulation with mouth forming second IEA -
GO:0001822 kidney development IEA -
GO:0007183 SMAD protein complex assembly IDA 10823886
GO:0006350 transcription IEA -
GO:0009952 anterior/posterior pattern formation IEA -
GO:0008285 negative regulation of cell proliferation IEA -
GO:0017015 regulation of transforming growth factor beta receptor signaling pathway IMP 8774881
GO:0051098 regulation of binding IEA -
GO:0030509 BMP signaling pathway EXP 15621726
GO:0032909 regulation of transforming growth factor-beta2 production IMP 12411310
GO:0030308 negative regulation of cell growth IDA 8774881
GO:0045892 negative regulation of transcription, DNA-dependent IDA 8774881
GO:0045944 positive regulation of transcription from RNA polymerase II promoter IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005829 cytosol EXP 9311995
GO:0005622 intracellular IEA -
GO:0005634 nucleus IEA -
GO:0005654 nucleoplasm EXP 10549282|11121043
GO:0005667 transcription factor complex 新闻学会 12374795
GO:0005737 cytoplasm IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B 官方full name B Experimental Source PubMed ID
ACVR1B ACTRIB | ACVRLK4 | ALK4 | SKR2 activin A receptor, type IB - HPRD 9892009
AKT1 AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHA v-akt murine thymoma viral oncogene homolog 1 Affinity Capture-Western BioGRID 16362038
AR AIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFM androgen receptor - HPRD,BioGRID 12226080
ATF2 CRE-BP1 | CREB2 | HB16 | MGC111558 | TREB7 activating transcription factor 2 - HPRD,BioGRID 10085140
BRCA1 BRCAI | BRCC1 | IRIS | PSCP | RNF53 breast cancer 1, early onset BRCA1 interacts with Smad4. This interaction was modeled on a demonstrated interaction between BRCA1 from human and Smad4 from an unspecified species. BIND 15735739
BTRC BETA-TRCP | FBW1A | FBXW1 | FBXW1A | FWD1 | MGC4643 | bTrCP | bTrCP1 | betaTrCP beta-transducin repeat containing - HPRD,BioGRID 14988407
CAMK2G CAMK | CAMK-II | CAMKG | FLJ16043 | MGC26678 calcium/calmodulin-dependent protein kinase II gamma - HPRD,BioGRID 11027280
CDKN1A CAP20 | CDKN1 | CIP1 | MDA-6 | P21 | SDI1 | WAF1 | p21CIP1 cyclin-dependent kinase inhibitor 1A (p21, Cip1) Smad4 binds the distal region of the p21Cip1 promoter. BIND 15084259
CEBPA C/EBP-alpha | CEBP CCAAT/enhancer binding protein (C/EBP), alpha Reconstituted Complex BioGRID 12524424
CEBPB C/EBP-beta | CRP2 | IL6DBP | LAP | MGC32080 | NF-IL6 | TCF5 CCAAT/enhancer binding protein (C/EBP), beta CEBPB (C/EBP-beta) interacts with SMAD4. This interaction was modeled on a demonstrated interaction between CEBPB and SMAD4, both from unspecified species. BIND 12202226
CEBPB C/EBP-beta | CRP2 | IL6DBP | LAP | MGC32080 | NF-IL6 | TCF5 CCAAT/enhancer binding protein (C/EBP), beta - HPRD,BioGRID 12524424
CEBPD C/EBP-delta | CELF | CRP3 | NF-IL6-beta CCAAT/enhancer binding protein (C/EBP), delta Affinity Capture-Western
Reconstituted Complex		 BioGRID 12524424
CITED1 MSG1 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 - HPRD,BioGRID 9707553
COPS5 CSN5 | JAB1 | MGC3149 | MOV-34 | SGN5 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) - HPRD,BioGRID 11818334
CTNNB1 CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 catenin (cadherin-associated protein), beta 1, 88kDa - HPRD,BioGRID 12000714
DACH1 DACH | FLJ10138 dachshund homolog 1 (Drosophila) - HPRD 14525983
DCP1A FLJ21691 | HSA275986 | Nbla00360 | SMAD4IP1 | SMIF DCP1 decapping enzyme homolog A (S. cerevisiae) - HPRD,BioGRID 11836524
DLX1 - distal-less homeobox 1 - HPRD,BioGRID 14671321
DVL1 DVL | MGC54245 dishevelled, dsh homolog 1 (Drosophila) Reconstituted Complex BioGRID 12650946
ECSIT SITPEC ECSIT homolog (Drosophila) - HPRD 14633973
EID2 CRI2 | EID-2 | MGC20452 EP300 interacting inhibitor of differentiation 2 - HPRD,BioGRID 14612439
EP300 KAT3B | p300 E1A binding protein p300 Affinity Capture-Western BioGRID 10887155
EP300 KAT3B | p300 E1A binding protein p300 p300 interacts with Smad4 fragment. p300 interacting with full-length Smad4 could not be demonstrated in vitro. This interaction was modeled on a demonstrated interaction between p300 from an unspecified species and human Smad4 fragment. BIND 9679056
ERBB2IP ERBIN | LAP2 erbb2 interacting protein - HPRD,BioGRID 12650946
EWSR1 EWS Ewing sarcoma breakpoint region 1 Two-hybrid BioGRID 16189514
FOXH1 1 | FAST1 forkhead box H1 Reconstituted Complex
Two-hybrid		 BioGRID 9288972
FOXO1 FKH1 | FKHR | FOXO1A forkhead box O1 FoxO1 interacts with Smad4. BIND 15084259
FOXO1 FKH1 | FKHR | FOXO1A forkhead box O1 - HPRD,BioGRID 15084259
FOXO3 AF6q21 | DKFZp781A0677 | FKHRL1 | FKHRL1P2 | FOXO2 | FOXO3A | MGC12739 | MGC31925 forkhead box O3 - HPRD,BioGRID 15084259
FOXO3 AF6q21 | DKFZp781A0677 | FKHRL1 | FKHRL1P2 | FOXO2 | FOXO3A | MGC12739 | MGC31925 forkhead box O3 FoxO3 interacts with Smad4. BIND 15084259
FOXO4 AFX | AFX1 | MGC120490 | MLLT7 forkhead box O4 - HPRD,BioGRID 15084259
FOXO4 AFX | AFX1 | MGC120490 | MLLT7 forkhead box O4 FoxO4 interacts with Smad4. BIND 15084259
FSTL3 FLRG | FSRP follistatin-like 3 (secreted glycoprotein) - HPRD 11571638
GLI3 ACLS | GCPS | PAP-A | PAPA | PAPA1 | PAPB | PHS | PPDIV GLI-Kruppel family member GLI3 - HPRD 9843199
HOXA9 ABD-B | HOX1 | HOX1.7 | HOX1G | MGC1934 homeobox A9 - HPRD,BioGRID 11042172
HOXC8 HOX3 | HOX3A 同源框C8 - HPRD,BioGRID 10224145
JUN AP-1 | AP1 | c-Jun jun oncogene - HPRD 10220381
JUNB AP-1 jun B proto-oncogene - HPRD,BioGRID 10220381
JUND AP-1 jun D proto-oncogene - HPRD 10220381
KPNB1 IMB1 | IPOB | Impnb | MGC2155 | MGC2156 | MGC2157 | NTF97 karyopherin (importin) beta 1 Affinity Capture-Western BioGRID 10846168
LEF1 DKFZp586H0919 | TCF1ALPHA lymphoid enhancer-binding factor 1 - HPRD,BioGRID 10890911
MAX MGC10775 | MGC11225 | MGC18164 | MGC34679 | MGC36767 | bHLHd4 | orf1 MYC associated factor X - HPRD,BioGRID 12551947
MDM4 DKFZp781B1423 | HDMX | MDMX | MGC132766 | MRP1 Mdm4 p53 binding protein homolog (mouse) Reconstituted Complex BioGRID 12483531
MED15 ARC105 | CAG7A | CTG7A | DKFZp686A2214 | DKFZp762B1216 | FLJ42282 | FLJ42935 | PCQAP | TIG-1 | TIG1 | TNRC7 mediator complex subunit 15 - HPRD 12167862
MEF2A ADCAD1 | RSRFC4 | RSRFC9 myocyte enhancer factor 2A - HPRD 11160896
PARD3B ALS2CR19 | MGC16131 | PAR3B | PAR3L | PAR3LC | PAR3beta | Par3Lb par-3 partitioning defective 3 homolog B (C. elegans) Reconstituted Complex BioGRID 12650946
PIAS3 FLJ14651 | ZMIZ5 protein inhibitor of activated STAT, 3 - HPRD,BioGRID 14691252
PIAS4 FLJ12419 | MGC35296 | PIASY | Piasg | ZMIZ6 protein inhibitor of activated STAT, 4 Affinity Capture-Western BioGRID 12815042
RBL1 CP107 | MGC40006 | PRB1 | p107 retinoblastoma-like 1 (p107) - HPRD,BioGRID 12150994
SKI SKV v-ski sarcoma viral oncogene homolog (avian) - HPRD,BioGRID 12419246|12857746
SKI SKV v-ski sarcoma viral oncogene homolog (avian) Smad4 interacts with Ski. This interaction was modeled on a demonstrated interaction between human Smad4 and Ski from an unspecified species. BIND 15761153
SKI SKV v-ski sarcoma viral oncogene homolog (avian) c-Ski interacts with Smad4. This interaction was modelled on a demonstrated interaction between Smad4 from an unspecified source and human c-Ski. BIND 10575014
SKIL SNO | SnoA | SnoN SKI-like oncogene Smad4 interacts with SnoN. This interaction was modeled on a demonstrated interaction between human Smad4 and SnoN from an unspecified species. BIND 15761153
SKIL SNO | SnoA | SnoN SKI-like oncogene - HPRD,BioGRID 10531062
SMAD1 BSP1 | JV4-1 | JV41 | MADH1 | MADR1 SMAD家庭member 1 - HPRD 10400705|11700304
SMAD1 BSP1 | JV4-1 | JV41 | MADH1 | MADR1 SMAD家庭member 1 Affinity Capture-Western
Co-fractionation		 BioGRID 10531362|11700304
|12874272
SMAD1 BSP1 | JV4-1 | JV41 | MADH1 | MADR1 SMAD家庭member 1 Smad4 interacts with Smad1. BIND 15761153
SMAD2 JV18 | JV18-1 | MADH2 | MADR2 | MGC22139 | MGC34440 | hMAD-2 | hSMAD2 SMAD家庭member 2 - HPRD,BioGRID 11274206
SMAD2 JV18 | JV18-1 | MADH2 | MADR2 | MGC22139 | MGC34440 | hMAD-2 | hSMAD2 SMAD家庭member 2 Smad4 interacts with Smad2. BIND 15761153
SMAD2 JV18 | JV18-1 | MADH2 | MADR2 | MGC22139 | MGC34440 | hMAD-2 | hSMAD2 SMAD家庭member 2 Smad2 interacts with Smad4. This interaction was modeled on a demonstrated interaction between Smad2 from an unspecified species and Smad4 from an unspecified species. BIND 9311995
SMAD3 DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 SMAD家庭member 3 - HPRD 9311995|9732876
SMAD3 DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 SMAD家庭member 3 Smad3 interacts with Smad4. This interaction was modeled on a demonstrated interaction between Smad3 from an unspecified species and Smad4 from an unspecified species. BIND 9311995
SMAD3 DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 SMAD家庭member 3 Smad4 interacts with Smad3. BIND 15761153
SMAD3 DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 SMAD家庭member 3 Affinity Capture-Western BioGRID 9311995|9892009
|10531362|11114293
|12419246|12794086
|15084259
SMAD5 DKFZp781C1895 | DKFZp781O1323 | Dwfc | JV5-1 | MADH5 SMAD家庭member 5 Affinity Capture-Western BioGRID 10531362
SMAD7 CRCS3 | FLJ16482 | MADH7 | MADH8 SMAD家庭member 7 Phenotypic Suppression BioGRID 9892009
SMAD9 MADH6 | MADH9 | SMAD8A | SMAD8B SMAD家庭member 9 Affinity Capture-Western
Two-hybrid		 BioGRID 10583507|16189514
SNIP1 FLJ12553 | RP3-423B22.3 | dJ423B22.2 Smad nuclear interacting protein 1 - HPRD,BioGRID 10887155
SNW1 Bx42 | MGC119379 | NCOA-62 | PRPF45 | Prp45 | SKIIP | SKIP SNW domain containing 1 Phenotypic Enhancement
Two-hybrid		 BioGRID 11278756
SP1 - Sp1 transcription factor - HPRD 11432852
SPTBN1 ELF | SPTB2 | betaSpII spectrin, beta, non-erythrocytic 1 - HPRD 12543979
STK11IP KIAA1898 | LIP1 | LKB1IP | STK11IP1 serine/threonine kinase 11 interacting protein - HPRD,BioGRID 11741830
STUB1 CHIP | HSPABP2 | NY-CO-7 | SDCCAG7 | UBOX1 STIP1 homology and U-box containing protein 1 Smad4 interacts with CHIP. This interaction was modeled on a demonstrated interaction between Smad1 and CHIP, both from an unspecified species. BIND 15708501
SUMO1 DAP-1 | GMP1 | OFC10 | PIC1 | SENP2 | SMT3 | SMT3C | SMT3H3 | SUMO-1 | UBL1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) SMAD4 is sumoylated. BIND 15592428
TFE3 RCCP2 | TFEA | bHLHe33 转录因子结合ing to IGHM enhancer 3 - HPRD,BioGRID 10557285
TGFB1I1 ARA55 | HIC-5 | HIC5 | TSC-5 transforming growth factor beta 1 induced transcript 1 ARA55 interacts with Smad4. This interaction was modeled on a demonstrated interaction between human ARA55 and Smad4 from an unspecified species. BIND 15561701
TGFBR1 AAT5 | ACVRLK4 | ALK-5 | ALK5 | LDS1A | LDS2A | SKR4 | TGFR-1 transforming growth factor, beta receptor 1 T-beta-RI磷酸化hMAD-4。这种交互was modeled on a demonstrated interaction between T-beta-RI from an unspecified species and human hMAD-4. BIND 8774881
TGFBR1 AAT5 | ACVRLK4 | ALK-5 | ALK5 | LDS1A | LDS2A | SKR4 | TGFR-1 transforming growth factor, beta receptor 1 Co-fractionation BioGRID 11102446
TGFBR2 AAT3 | FAA3 | LDS1B | LDS2B | MFS2 | RIIC | TAAD2 | TGFR-2 | TGFbeta-RII transforming growth factor, beta receptor II (70/80kDa) T-beta-RII phosphorylates hMAD-4. This interaction was modeled on a demonstrated interaction between T-beta-RII from an unspecified species and human hMAD-4. BIND 8774881
TGFBRAP1 TRAP-1 | TRAP1 transforming growth factor, beta receptor associated protein 1 - HPRD,BioGRID 11278302
TOB1 APRO6 | MGC104792 | MGC34446 | PIG49 | TOB | TROB | TROB1 transducer of ERBB2, 1 - HPRD,BioGRID 11163184
TRIM33 FLJ32925 | PTC7 | RFG7 | TF1G | TIF1G | TIF1GAMMA | TIFGAMMA tripartite motif-containing 33 Smad4 interacts with Ecto. BIND 15820681
TSSK3 SPOGA3 | STK22C | STK22D testis-specific serine kinase 3 SMAD4 interacts with STK22C. This interaction was modeled on a demonstrated interaction between human SMAD4 and mouse STK22C. BIND 15761153
UBE2I C358B7.1 | P18 | UBC9 ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Two-hybrid BioGRID 16189514
UBE2L3 E2-F1 | L-UBC | UBCH7 | UbcM4 ubiquitin-conjugating enzyme E2L 3 - HPRD 12794086
ZNF423 Ebfaz | KIAA0760 | MGC138520 | MGC138522 | OAZ | Roaz | ZFP423 | Zfp104 zinc finger protein 423 - HPRD,BioGRID 10660046
ZNF521 DKFZp564D0764 | EHZF | Evi3 | MGC142182 | MGC142208 zinc finger protein 521 - HPRD 14630787
ZNF8 HF.18 | Zfp128 zinc finger protein 8 - HPRD 12370310


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG CELL CYCLE 128 84 All SZGR 2.0 genes in this pathway
KEGG WNT SIGNALING PATHWAY 151 112 All SZGR 2.0 genes in this pathway
KEGG TGF BETA SIGNALING PATHWAY 86 64 All SZGR 2.0 genes in this pathway
KEGG ADHERENS JUNCTION 75 53 All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER 328 259 All SZGR 2.0 genes in this pathway
KEGG COLORECTAL CANCER 62 47 All SZGR 2.0 genes in this pathway
KEGG PANCREATIC CANCER 70 56 All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA 73 59 All SZGR 2.0 genes in this pathway
BIOCARTA ALK PATHWAY 37 29 All SZGR 2.0 genes in this pathway
BIOCARTA G1 PATHWAY 28 21 All SZGR 2.0 genes in this pathway
BIOCARTA CTCF PATHWAY 23 18 All SZGR 2.0 genes in this pathway
BIOCARTA NTHI PATHWAY 24 20 All SZGR 2.0 genes in this pathway
BIOCARTA TOB1 PATHWAY 21 14 All SZGR 2.0 genes in this pathway
BIOCARTA TGFB PATHWAY 19 14 All SZGR 2.0 genes in this pathway
BIOCARTA WNT PATHWAY 26 24 All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY 82 63 All SZGR 2.0 genes in this pathway
PID MYC ACTIV PATHWAY 79 62 All SZGR 2.0 genes in this pathway
PID LKB1 PATHWAY 47 37 All SZGR 2.0 genes in this pathway
PID BMP PATHWAY 42 31 All SZGR 2.0 genes in this pathway
PID ALK1 PATHWAY 26 21 All SZGR 2.0 genes in this pathway
PID ERA GENOMIC PATHWAY 65 37 All SZGR 2.0 genes in this pathway
PID ALK2 PATHWAY 11 9 All SZGR 2.0 genes in this pathway
PID SMAD2 3PATHWAY 17 13 All SZGR 2.0 genes in this pathway
PID MYC REPRESS PATHWAY 63 52 All SZGR 2.0 genes in this pathway
PID HIF1 TFPATHWAY 66 52 All SZGR 2.0 genes in this pathway
PID TGFBR PATHWAY 55 38 All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY 396 292 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NODAL 18 11 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY BMP 23 15 All SZGR 2.0 genes in this pathway
REACTOME SMAD2 SMAD3 SMAD4 HETEROTRIMER REGULATES TRANSCRIPTION 27 17 All SZGR 2.0 genes in this pathway
REACTOME TGF BETA RECEPTOR SIGNALING ACTIVATES SMADS 26 16 All SZGR 2.0 genes in this pathway
REACTOME TRANSCRIPTIONAL ACTIVITY OF SMAD2 SMAD3 SMAD4 HETEROTRIMER 38 26 All SZGR 2.0 genes in this pathway
REACTOME DOWNREGULATION OF SMAD2 3 SMAD4 TRANSCRIPTIONAL ACTIVITY 20 14 All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY 352 181 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY TGF BETA RECEPTOR COMPLEX 63 42 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP 485 293 All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE DN 244 147 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP 30.5 185 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP 431 237 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR DN 129 84 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805 505 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537 339 All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP 128 95 All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP 117 84 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN 485 334 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 XPCS DN 88 71 All SZGR 2.0 genes in this pathway
TURJANSKI MAPK1 AND MAPK2 TARGETS 12 10 All SZGR 2.0 genes in this pathway
BREUHAHN GROWTH FACTOR SIGNALING IN LIVER CANCER 22 19 All SZGR 2.0 genes in this pathway
HUMMERICH SKIN CANCER PROGRESSION DN 100 64 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN 203 134 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
WEI MIR34A TARGETS 148 97 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424 268 All SZGR 2.0 genes in this pathway
DER IFN ALPHA RESPONSE UP 74 48 All SZGR 2.0 genes in this pathway
DER IFN BETA RESPONSE UP 102 67 All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN 546 351 All SZGR 2.0 genes in this pathway
MA MYELOID DIFFERENTIATION DN 44 30. All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER BRCA1 VS BRCA2 163 113 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA RADIATION 81 59 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP 226 164 All SZGR 2.0 genes in this pathway
STEARMAN LUNG CANCER EARLY VS LATE UP 125 89 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN 543 317 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP 323 240 All SZGR 2.0 genes in this pathway
GU PDEF TARGETS UP 71 49 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-146 390 397 1A,m8 hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrain UGAGAACUGAAUUCCAUAGGCU
miR-224 1194 1200 m8 hsa-miR-224 CAAGUCACUAGUGGUUCCGUUUA
hsa-miR-224 CAAGUCACUAGUGGUUCCGUUUA
miR-26 1034 1040 m8 hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU
miR-346 146 152 1A hsa-miR-346brain UGUCUGCCCGCAUGCCUGCCUCU
miR-376c 966 972 m8 hsa-miR-376c AACAUAGAGGAAAUUCCACG
miR-431 1121 1127 m8 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
miR-544 982 988 m8 hsa-miR-544 AUUCUGCAUUUUUAGCAAGU