Gene Page:MAK

Summary?
GeneID 4117
Symbol MAK
Synonyms RP62
Description male germ cell associated kinase
Reference MIM:154235|HGNC:HGNC:6816|Ensembl:ENSG00000111837|HPRD:01101|Vega:OTTHUMG00000014247
Gene type protein-coding
Map location 6p24
Pascal p-value 0.893
Fetal beta 1.35
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.0159
Literature High-throughput literature-search 与Schi Co-occurancezophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs7370564 0 MAK 4117 0.14 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
STXBP5L 0.81 0.74
DGKG 0.78 0.69
ZBTB16 0.78 0.68
NPTX1 0.77 0.79
LUZP1 0.77 0.61
SLC4A10 0.76 0.68
ARHGAP26 0.76 0.67
CADPS2 0.76 0.78
CREG2 0.76 0.72
SLC45A4 0.76 0.64
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
BCL7C -0.38 -0.56
FAM36A -0.34 -0.32
HEBP2 -0.34 -0.54
RPL35 -0.33 -0.40
SH3BP2 -0.33 -0.45
FADS2 -0.33 -0.36
C9orf46 -0.32 -0.42
SH2B2 -0.32 -0.45
TRAF4 -0.31 -0.45
PKN1 -0.31 -0.36

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004693 cyclin-dependent protein kinase activity IEA neuron (GO term level: 8) -
GO:0000166 nucleotide binding IEA -
GO:0005524 ATP binding NAS -
GO:0016740 transferase activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006468 protein amino acid phosphorylation NAS -
GO:0007283 spermatogenesis NAS 2183027
GO:0007275 multicellular organismal development IEA -
GO:0030154 cell differentiation IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID AR PATHWAY 61 46 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP 485 293 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
HU GENOTOXIN ACTION DIRECT VS INDIRECT 4HR 37 22 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 473 224 All SZGR 2.0 genes in this pathway
HILLION HMGA1 TARGETS 90 71 All SZGR 2.0 genes in this pathway
HILLION HMGA1B TARGETS 92 68 All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3 491 310 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701 446 All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION 175 125 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-101 1398 1405 1A,m8 hsa-miR-101 UACAGUACUGUGAUAACUGAAG
miR-144 1399 1405 1A hsa-miR-144 UACAGUAUAGAUGAUGUACUAG
miR-182 242 249 1A,m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-543 1426 1432 1A hsa-miR-543 AAACAUUCGCGGUGCACUUCU
hsa-miR-543 AAACAUUCGCGGUGCACUUCU
miR-96 243 249 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC