Gene Page:MDK

Summary?
GeneID 4192
Symbol MDK
Synonyms ARAP|MK|NEGF2
Description midkine (neurite growth-promoting factor 2)
Reference MIM:162096|HGNC:HGNC:6972|Ensembl:ENSG00000110492|HPRD:01200|Vega:OTTHUMG00000150315
Gene type protein-coding
Map location 11p11.2
Pascal p-value 2.765E-10
Sherlock p-value 0.639
Fetal beta 0.985
DMG 1 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance与Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg00078194 11 46402949 MDK 2.84E-5 -0.2 0.018 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs17195543 chr11 45509795 MDK 4192 0.02 cis
rs947242 chr1 58042848 MDK 4192 0.05 trans
rs631503 chr1 72327801 MDK 4192 0.06 trans
rs11205098 chr1 152717431 MDK 4192 6.48E-4 trans
rs7518178 chr1 199424428 MDK 4192 0.18 trans
rs3013450 chr1 214552423 MDK 4192 0.08 trans
rs2374323 chr2 41898671 MDK 4192 5.147的军医 trans
rs17486127 chr2 72111878 MDK 4192 0 trans
rs17558168 chr2 72151944 MDK 4192 0 trans
rs7562379 chr2 76693222 MDK 4192 0.14 trans
rs4338920 chr2 141325591 MDK 4192 0.04 trans
rs222809 chr2 146893189 MDK 4192 0.07 trans
rs6726013 chr2 189064570 MDK 4192 2.414E-4 trans
rs6729020 chr2 189064719 MDK 4192 6.202E-6 trans
rs10166301 chr2 189947813 MDK 4192 0 trans
rs4680999 chr3 78613401 MDK 4192 0.11 trans
rs17088743 chr4 58668728 MDK 4192 0.01 trans
rs4425392 chr4 133569611 MDK 4192 0.17 trans
rs35129 chr5 6039853 MDK 4192 0.09 trans
rs447967 chr5 9999056 MDK 4192 0.14 trans
rs6874831 chr5 59155059 MDK 4192 4.156E-8 trans
rs7728346 chr5 59155166 MDK 4192 8.123E-10 trans
rs16890314 chr5 59158770 MDK 4192 4.597E-7 trans
rs10214307 chr5 59159746 MDK 4192 4.156E-8 trans
rs6893381 chr5 59160568 MDK 4192 9.95E-7 trans
rs10052099 chr5 99324715 MDK 4192 0.05 trans
rs10074374 chr5 99324809 MDK 4192 0.08 trans
rs545290 chr5 152858437 MDK 4192 0.08 trans
rs2294670 chr6 625834 MDK 4192 0.01 trans
rs9451867 chr6 92659609 MDK 4192 0.01 trans
rs9640055 chr7 8029515 MDK 4192 0.05 trans
rs17142255 chr7 8075258 MDK 4192 0.09 trans
rs1014201 chr7 25815736 MDK 4192 0.05 trans
rs2939687 chr8 56313877 MDK 4192 0.11 trans
rs10123219 chr9 74156668 MDK 4192 0.03 trans
rs4601388 chr9 94547922 MDK 4192 1.187E-4 trans
rs2006996 chr9 117592637 MDK 4192 0.16 trans
rs2229360 chr10 8116078 MDK 4192 0.15 trans
rs2225536 chr10 110354957 MDK 4192 0.16 trans
rs7933582 chr11 91178991 MDK 4192 0.14 trans
rs7953537 chr12 44693287 MDK 4192 0.07 trans
rs17094401 chr12 44696783 MDK 4192 0.19 trans
rs17094560 chr12 44769767 MDK 4192 0.07 trans
rs8013004 chr14 41098282 MDK 4192 0.01 trans
rs8013037 chr14 41098343 MDK 4192 0.11 trans
rs17105664 chr14 68926192 MDK 4192 0.18 trans
rs1515411 chr14 90614916 MDK 4192 0.16 trans
rs4457950 chr15 35445709 MDK 4192 0.06 trans
rs16969948 chr15 78864785 MDK 4192 0.14 trans
rs4550511 chr17 53340407 MDK 4192 0.18 trans
rs8071763 chr17 67930673 MDK 4192 3.829E-4 trans
rs7244040 chr18 13972023 MDK 4192 8.92E-8 trans
rs17681878 chr18 34767223 MDK 4192 0.18 trans
rs515453 chr18 72483272 MDK 4192 0.12 trans
rs4536719 chr20 24397114 MDK 4192 8.406E-4 trans
rs7887127 chrX 38436019 MDK 4192 1.645E-4 trans
rs871948 chrX 39342814 MDK 4192 7.043E-4 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
NEBL 0.87 0.87
EPB41L2 0.86 0.90
MFAP3L 0.85 0.89
ACSL6 0.85 0.89
MYLK 0.85 0.82
SYNM 0.84 0.89
SIRPA 0.84 0.91
KIAA0494 0.84 0.83
DTNA 0.84 0.87
TACC1 0.82 0.88
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
TUBB2B -0.62 -0.55
KIAA1949 -0.62 -0.49
BCL7C -0.62 -0.71
NXT1 -0.62 -0.66
RPS8 -0.61 -0.75
RPS19P3 -0.61 -0.78
RPS13P2 -0.61 -0.73
TRAF4 -0.61 -0.66
DYNLT1 -0.61 -0.74
ALKBH2 -0.61 -0.63

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0008201 heparin binding IDA 9384573
GO:0008083 growth factor activity IEA -
GO:0008083 growth factor activity NAS 1639750
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development NAS neurite (GO term level: 5) 9384573
GO:0007165 signal transduction NAS 7835084
GO:0008283 cell proliferation IEA -
GO:0009611 response to wounding ISS -
GO:0007275 multicellular organismal development IEA -
GO:0030154 cell differentiation NAS 1639750
GO:0030325 adrenal gland development ISS -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ACTG1 ACT | ACTG | DFNA20 | DFNA26 actin, gamma 1 Affinity Capture-MS BioGRID 10772929
JAK1 JAK1A | JAK1B | JTK3 Janus kinase 1 (a protein tyrosine kinase) - HPRD 9452495
JAK2 JTK10 Janus kinase 2 (a protein tyrosine kinase) - HPRD 9452495
LRP1 A2MR | APOER | APR | CD91 | FLJ16451 | IGFBP3R | LRP | MGC88725 | TGFBR5 low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) - HPRD,BioGRID 10772929
LRP2 DBS | gp330 low density lipoprotein-related protein 2 - HPRD 10772929
NCAM1 CD56 | MSK39 | NCAM neural cell adhesion molecule 1 Affinity Capture-MS BioGRID 10772929
NCL C23 | FLJ45706 nucleolin - HPRD,BioGRID 12147681
NID1 NID nidogen 1 Affinity Capture-MS BioGRID 10772929
NID2 - nidogen 2 (osteonidogen) Affinity Capture-MS BioGRID 10772929
PTPRB DKFZp686E2262 | DKFZp686H15164 | FLJ44133 | HPTP-BETA | HPTPB | MGC142023 | MGC59935 | PTPB | R-PTP-BETA | VEPTP protein tyrosine phosphatase, receptor type, B - HPRD 10706604
PTPRZ1 HPTPZ | HPTPzeta | PTP-ZETA | PTP18 | PTPRZ | PTPZ | RPTPB | RPTPbeta | phosphacan protein tyrosine phosphatase, receptor-type, Z polypeptide 1 - HPRD,BioGRID 10212223|10706604
RPL18A - ribosomal protein L18a Two-hybrid BioGRID 16169070
SDC1 CD138 | SDC | SYND1 | syndecan syndecan 1 - HPRD 9089390
SDC3 N-syndecan | SDCN | SYND3 syndecan 3 - HPRD 9089390
SDC4 MGC22217 | SYND4 syndecan 4 - HPRD 8621465
STAT1 DKFZp686B04100 | ISGF-3 | STAT91 signal transducer and activator of transcription 1, 91kDa - HPRD 9452495
TGM1 ICR2 | KTG | LI | LI1 | TGASE | TGK transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) - HPRD 9384573
TUBA1A B-ALPHA-1 | FLJ25113 | LIS3 | TUBA3 tubulin, alpha 1a Affinity Capture-MS BioGRID 10772929
TUBB2B DKFZp566F223 | FLJ98847 | MGC8685 | TUBB-PARALOG | bA506K6.1 tubulin, beta 2B Affinity Capture-MS BioGRID 10772929


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID INTEGRIN1 PATHWAY 66 44 All SZGR 2.0 genes in this pathway
PID SYNDECAN 4通道 32 25 All SZGR 2.0 genes in this pathway
PID INTEGRIN A4B1 PATHWAY 33 24 All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE DN 84 53 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 DN 242 165 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 DN 281 186 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP 443 294 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK UP 271 175 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL DN 186 107 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD UP 64 39 All SZGR 2.0 genes in this pathway
ROVERSI GLIOMA COPY NUMBER UP 100 75 All SZGR 2.0 genes in this pathway
LI AMPLIFIED IN LUNG CANCER 178 108 All SZGR 2.0 genes in this pathway
LUI THYROID CANCER CLUSTER 1 51 33 All SZGR 2.0 genes in this pathway
KORKOLA YOLK SAC TUMOR 62 33 All SZGR 2.0 genes in this pathway
DACOSTA ERCC3 ALLELE XPCS VS TTD UP 28 19 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP 309 199 All SZGR 2.0 genes in this pathway
HEIDENBLAD AMPLICON 8Q24 DN 46 28 All SZGR 2.0 genes in this pathway
FURUKAWA DUSP6 TARGETS PCI35 UP 74 32 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS SUBSET 33 20 All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP 266 171 All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN 200 112 All SZGR 2.0 genes in this pathway
SHEPARD BMYB TARGETS 74 41 All SZGR 2.0 genes in this pathway
挞挞浆细胞和PLASMABLAST UP 398 262 All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN 185 111 All SZGR 2.0 genes in this pathway
HADDAD T LYMPHOCYTE AND NK PROGENITOR UP 78 56 All SZGR 2.0 genes in this pathway
LEI MYB目标 318 215 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 AND CD2 UP 89 51 All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP 249 170 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS UP 37 27 All SZGR 2.0 genes in this pathway
KANG FLUOROURACIL RESISTANCE UP 22 15 All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN MGMT 24HR DN 33 21 All SZGR 2.0 genes in this pathway
ZHANG ANTIVIRAL RESPONSE TO RIBAVIRIN UP 30 21 All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX DN 88 58 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP 428 266 All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL 311 205 All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN WITHOUT MGMT 48HR DN 32 25 All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN 161 105 All SZGR 2.0 genes in this pathway
BACOLOD RESISTANCE TO ALKYLATING AGENTS UP 26 17 All SZGR 2.0 genes in this pathway
WANG LSD1 TARGETS UP 24 14 All SZGR 2.0 genes in this pathway
KANG CISPLATIN RESISTANCE UP 19 11 All SZGR 2.0 genes in this pathway
SASAI TARGETS OF CXCR6 AND PTCH1 DN 8 6 All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN 138 92 All SZGR 2.0 genes in this pathway
YAMASHITA LIVER CANCER WITH EPCAM UP 53 25 All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION 368 247 All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP 166 105 All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 12 79 54 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 UP 140 94 All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462 273 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS 344 197 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124/506 90 96 m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC