Gene Page:MFAP3

Summary?
GeneID 4238
Symbol MFAP3
Synonyms -
Description microfibrillar associated protein 3
Reference MIM:600491|HGNC:HGNC:7034|HPRD:02731|
Gene type protein-coding
Map location 5q32-q33.2
Pascal p-value 9.831E-5
Fetal beta 1.041
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
GSMA_I Genome scan meta-analysis Psr: 0.0032
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00459
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01718

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs2948491 chrX 40180688 MFAP3 4238 0.19 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP 276 165 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP 341 197 All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP 457 269 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP 722 443 All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP 177 113 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP 309 199 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER UP 227 137 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN 382 224 All SZGR 2.0 genes in this pathway
KUROKAWA LIVER CANCER CHEMOTHERAPY UP 12 8 All SZGR 2.0 genes in this pathway
CROMER METASTASIS UP 79 46 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN 543 317 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR UP 61 44 All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN 157 106 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN 784 464 All SZGR 2.0 genes in this pathway
NABA ECM GLYCOPROTEINS 196 99 All SZGR 2.0 genes in this pathway
NABA CORE MATRISOME 275 148 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-182 139 146 1A,m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-29 1047 1054 1A,m8 hsa-miR-29aSZ UAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZ UAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZ UAGCACCAUUUGAAAUCGGU
miR-96 140 146 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC