Gene Page:UNC13C

Summary?
GeneID 440279
Symbol UNC13C
Synonyms -
Description unc-13 homolog C (C. elegans)
Reference MIM:614568|HGNC:HGNC:23149|
Gene type protein-coding
Map location 15q21.3
Pascal p-value 0.012
Sherlock p-value 0.881
TADA p-value 0.024
Fetal beta -2.569
eGene Cerebellum
Support CANABINOID
EXOCYTOSIS
METABOTROPIC GLUTAMATE RECEPTOR
SEROTONIN
CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DNM:Xu_2012 Whole Exome Sequencing analysis 新创4基因的突变were identified by exome sequencing of 795 samples in this study
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
UNC13C chr15 54586124 G T NM_001080534 p.1284V>F missense Schizophrenia DNM:Xu_2012


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0008270 zinc ion binding IEA -
GO:0019992 diacylglycerol binding IEA -
GO:0046872 metal ion binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007268 synaptic transmission IEA neuron, Synap, Neurotransmitter (GO term level: 6) -
GO:0007242 intracellular signaling cascade IEA -
GO:0006887 exocytosis IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0045202 synapse IEA neuron, Synap, Neurotransmitter, Glial (GO term level: 2) -
GO:0005737 cytoplasm IEA -
GO:0005886 plasma membrane IEA -
GO:0030054 cell junction IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
XU GH1 EXOGENOUS TARGETS UP 85 50 All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP 268 157 All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN 258 160 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-128 568 575 1A,m8 hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-137 604 610 m8 hsa-miR-137 UAUUGCUUAAGAAUACGCGUAG
miR-182 193 199 1A hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-186 749 756 1A,m8 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU
miR-27 569 576 1A,m8 hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-330 1405 1411 m8 hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-34/449 665 671 1A hsa-miR-34abrain UGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449 UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
miR-495 1408 1414 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-496 206 212 1A hsa-miR-496 AUUACAUGGCCAAUCUC
miR-543 69 75 m8 hsa-miR-543 AAACAUUCGCGGUGCACUUCU
miR-96 192 199 1A,m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC