Gene Page:MST1R

Summary?
GeneID 4486
Symbol MST1R
Synonyms CD136|CDw136|PTK8|RON
Description macrophage stimulating 1 receptor
Reference MIM:600168|HGNC:HGNC:7381|Ensembl:ENSG00000164078|HPRD:02545|Vega:OTTHUMG00000156709
Gene type protein-coding
Map location 3p21.3
Pascal p-value 0.001
Fetal beta 0.635
DMG 1 (# studies)
eGene Cerebellar Hemisphere
Cerebellum
Cortex

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0161

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg24980367 3 49941378 MST1R 2.03E-8 -0.013 7.02E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
某fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0005011 macrophage colony stimulating factor receptor activity TAS 9045873
GO:0004872 receptor activity IEA -
GO:0005524 ATP binding IEA -
GO:0016740 transferase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006468 protein amino acid phosphorylation IEA -
GO:0007338 single fertilization TAS 9045873
GO:0007165 signal transduction TAS 7939629
GO:0008284 positive regulation of cell proliferation TAS 10871856
GO:0006952 defense response TAS 9045873
GO:0006928 cell motion TAS 9045873
GO:0007275 multicellular organismal development IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0001725 stress fiber IEA -
GO:0005886 plasma membrane IEA -
GO:0005887 integral to plasma membrane TAS 7939629

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID AMB2 NEUTROPHILS PATHWAY 41 32 All SZGR 2.0 genes in this pathway
PID A6B1 A6B4整合素途径 46 35 All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN 258 141 All SZGR 2.0 genes in this pathway
COLDREN GEFITINIB RESISTANCE DN 230 115 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP 443 294 All SZGR 2.0 genes in this pathway
HERNANDEZ MITOTIC ARREST BY DOCETAXEL 2 DN 19 13 All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS 775 494 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN 464 276 All SZGR 2.0 genes in this pathway
NUMATA CSF3 SIGNALING VIA STAT3 22 17 All SZGR 2.0 genes in this pathway
KANG FLUOROURACIL RESISTANCE DN 16 10 All SZGR 2.0 genes in this pathway
BILD MYC ONCOGENIC SIGNATURE 206 117 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3 126 83 All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC 1103 714 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3 137 85 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP 682 433 All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 403 240 All SZGR 2.0 genes in this pathway
WANG MLL TARGETS 289 188 All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN 784 464 All SZGR 2.0 genes in this pathway
BRIDEAU IMPRINTED GENES 63 47 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-324-3p 242 248 1A hsa-miR-324-3p CCACUGCCCCAGGUGCUGCUGG