Gene Page:MSX1

Summary?
GeneID 4487
Symbol MSX1
Synonyms ECTD3|HOX7|HYD1|STHAG1
Description msh homeobox 1
Reference MIM:142983|HGNC:HGNC:7391|Ensembl:ENSG00000163132|HPRD:00866|Vega:OTTHUMG00000090335
Gene type protein-coding
Map location 4p16.2
Pascal p-value 0.126
Sherlock p-value 0.516
Fetal beta 0.081
DMG 2(#研究)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
PMID:cooccur High-throughput literature-search 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg07462756 4 4859985 MSX1 4.674E-4 -0.29 0.046 DMG:Wockner_2014
cg20161179 4 4863282 MSX1 5.24E-8 -0.026 1.37E-5 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs7191772 chr16 59567415 MSX1 4487 0.19 trans
rs11094893 chrX 23186987 MSX1 4487 0.14 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity IEA -
GO:0005515 protein binding IEA -
GO:0016564 transcription repressor activity IEA -
GO:0043565 sequence-specific DNA binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0030901 midbrain development IEA Brain (GO term level: 8) -
GO:0030900 forebrain development IEA Brain (GO term level: 8) -
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IEA -
GO:0001501 skeletal system development TAS 8696335
GO:0001701 in utero embryonic development IEA -
GO:0003007 heart morphogenesis IEA -
GO:0008285 negative regulation of cell proliferation IEA -
GO:0007517 muscle development IEA -
GO:0007275 multicellular organismal development IEA -
GO:0043066 negative regulation of apoptosis IEA -
GO:0030509 BMP signaling pathway IEA -
GO:0030326 embryonic limb morphogenesis IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
CREBBP CBP | KAT3A | RSTS CREB binding protein - HPRD,BioGRID 10215616|11115394
DLX2 TES-1 | TES1 distal-less homeobox 2 Reconstituted Complex
Two-hybrid		 BioGRID 9111364
DLX5 - distal-less homeobox 5 Reconstituted Complex BioGRID 9111364
HOXC8 HOX3 | HOX3A homeobox C8 Reconstituted Complex BioGRID 9111364
LHX2 LH2 | MGC138390 | hLhx2 LIM homeobox 2 - HPRD,BioGRID 9697309
MSX1 HOX7 | HYD1 msh homeobox 1 Reconstituted Complex
Two-hybrid		 BioGRID 9111364
MSX2 CRS2 | FPP | HOX8 | MSH | PFM | PFM1 msh homeobox 2 - HPRD,BioGRID 9111364
PAX3 CDHS | HUP2 | MGC120381 | MGC120382 | MGC120383 | MGC120384 | MGC134778 | WS1 paired box 3 Reconstituted Complex BioGRID 10529415
RGS7 - regulator of G-protein signaling 7 - HPRD 10862767
SP1 - Sp1 transcription factor - HPRD,BioGRID 10215616
TAF1 BA2R | CCG1 | CCGS | DYT3 | KAT4 | N-TAF1 | NSCL2 | OF | P250 | TAF2A | TAFII250 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa - HPRD,BioGRID 8700832
TBP GTF2D | GTF2D1 | MGC117320 | MGC126054 | MGC126055 | SCA17 | TFIID TATA box binding protein Affinity Capture-Western
in vivo
Phenotypic Suppression
Reconstituted Complex		 BioGRID 8700832|9111364
|10215616
TBP GTF2D | GTF2D1 | MGC117320 | MGC126054 | MGC126055 | SCA17 | TFIID TATA box binding protein - HPRD 8700832|10215616
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 MSX1 interacts with TP53 (p53). This interaction was modeled on a demonstrated interaction between MSX1 from an unspecified species, and human p53. BIND 15705871


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
HOLLMANN APOPTOSIS VIA CD40 DN 267 178 All SZGR 2.0 genes in this pathway
ROY WOUND BLOOD VESSEL UP 50 30 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP 85 54 All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN 240 171 All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP 146 99 All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA UP 141 75 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR UP 162 116 All SZGR 2.0 genes in this pathway
VANHARANTA UTERINE FIBROID DN 67 45 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC 35 25 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX 795 478 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12目标 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
TESAR ALK TARGETS HUMAN ES 5D UP 5 5 All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP 266 171 All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP 398 262 All SZGR 2.0 genes in this pathway
BECKER TAMOXIFEN RESISTANCE DN 52 37 All SZGR 2.0 genes in this pathway
SASAKI ADULT T CELL LEUKEMIA 176 122 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS UP 126 84 All SZGR 2.0 genes in this pathway
ZHANG TARGETS OF EWSR1 FLI1 FUSION 88 68 All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR 293 193 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA DN 41 27 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP 240 152 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
ZHU CMV ALL UP 120 89 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR UP 101 69 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR UP 71 48 All SZGR 2.0 genes in this pathway
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 419 273 All SZGR 2.0 genes in this pathway
ZHU CMV 8 HR UP 47 39 All SZGR 2.0 genes in this pathway
LEIN CHOROID PLEXUS MARKERS 103 61 All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC 58 43 All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN 220 147 All SZGR 2.0 genes in this pathway
TESAR ALK TARGETS EPISC 3D UP 7 7 All SZGR 2.0 genes in this pathway
TESAR ALK TARGETS EPISC 4D UP 7 6 All SZGR 2.0 genes in this pathway
TESAR ALK AND JAK TARGETS MOUSE ES D4 UP 5 5 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP 317 208 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP 461 298 All SZGR 2.0 genes in this pathway
AMUNDSON GAMMA RADIATION RESPONSE 40 25 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
HANN RESISTANCE TO BCL2 INHIBITOR DN 48 31 All SZGR 2.0 genes in this pathway
PODAR RESPONSE TO ADAPHOSTIN UP 147 98 All SZGR 2.0 genes in this pathway
TOOKER GEMCITABINE RESISTANCE DN 122 84 All SZGR 2.0 genes in this pathway
ZAIDI OSTEOBLAST TRANSCRIPTION FACTORS 14 12 All SZGR 2.0 genes in this pathway
HOFMANN MYELODYSPLASTIC SYNDROM LOW RISK UP 22 15 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745 475 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-101 717 723 1A hsa-miR-101 UACAGUACUGUGAUAACUGAAG
miR-144 716 723 1A,m8 hsa-miR-144 UACAGUAUAGAUGAUGUACUAG
miR-21 781 787 1A hsa-miR-21brain UAGCUUAUCAGACUGAUGUUGA
hsa-miR-590 GAGCUUAUUCAUAAAAGUGCAG
miR-329 700 706 1A hsa-miR-329brain AACACACCUGGUUAACCUCUUU
miR-369-3p 748 754 1A hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
miR-374 748 754 m8 hsa-miR-374 UUAUAAUACAACCUGAUAAGUG
miR-495 761 767 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU