Gene Page:MYF6

Summary?
GeneID 4618
Symbol MYF6
Synonyms CNM3|MRF4|bHLHc4|myf-6
Description myogenic factor 6
Reference MIM:159991|HGNC:HGNC:7566|Ensembl:ENSG00000111046|HPRD:01169|Vega:OTTHUMG00000170165
Gene type protein-coding
Map location 12q21
Pascal p-value 0.919
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg05860723 12 81102486 MYF6 4.158E-4 -0.285 0.044 DMG:Wockner_2014
cg05981335 12 81102562 MYF6 5.723E-4 -0.255 0.049 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconceptionweeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
CDKL5 0.94 0.96
FAM126B 0.94 0.96
PLEKHM3 0.94 0.95
LONRF2 0.93 0.96
HECW2 0.93 0.94
C9orf126 0.93 0.92
MYCBP2 0.92 0.92
TMOD2 0.92 0.93
LMTK2 0.92 0.93
MAP2 0.92 0.94
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
RAB34 -0.57 -0.65
DBI -0.55 -0.65
RHOC -0.55 -0.65
ACSF2 -0.55 -0.61
EFEMP2 -0.54 -0.57
EIF4EBP3 -0.54 -0.60
C1orf61 -0.54 -0.74
TLCD1 -0.54 -0.57
FXYD1 -0.53 -0.57
ENHO -0.53 -0.62

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity TAS 2311584
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007519 skeletal muscle development TAS neuron (GO term level: 8) 2311584
GO:0001756 somitogenesis IEA -
GO:0006357 regulation of transcription from RNA polymerase II promoter TAS 2311584
GO:0007517 muscle development IEA -
GO:0007275 multicellular organismal development IEA -
GO:0016481 negative regulation of transcription IEA -
GO:0030154 cell differentiation IEA -
GO:0045941 positive regulation of transcription IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus TAS 2311584

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID CMYB PATHWAY 84 61 All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY 396 292 All SZGR 2.0 genes in this pathway
REACTOME MYOGENESIS 28 20 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL FLI1 9 8 All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH CHROMOSOME 12 TRISOMY 24 12 All SZGR 2.0 genes in this pathway
SUZUKI RESPONSE TO TSA AND DECITABINE 1B 23 14 All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN 228 146 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP 244 151 All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G1 67 41 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 DN 228 114 All SZGR 2.0 genes in this pathway
BASSO HAIRY CELL LEUKEMIA DN 80 66 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE DN 264 159 All SZGR 2.0 genes in this pathway
SUZUKI CTCFL TARGETS UP 12 5 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-299-5p 422 428 m8 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU