Gene Page:NCAM2
Summary?
GeneID | 4685 |
Symbol | NCAM2 |
Synonyms | NCAM21 |
Description | neural cell adhesion molecule 2 |
Reference | MIM:602040|HGNC:HGNC:7657|Ensembl:ENSG00000154654|HPRD:03619| |
Gene type | protein-coding |
Map location | 21q21.1 |
Pascal p-value | 0.038 |
Sherlock p-value | 0.307 |
Fetal beta | -1.986 |
DMG | 1 (# studies) |
eGene | 元 |
Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg13297960 | 21 | 22370237 | NCAM2 | 3.302E-4 | 0.369 | 0.041 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/NCAM2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AC025647.1 | 0.91 | 0.89 |
MRPS33 | 0.88 | 0.80 |
TMEM126B | 0.87 | 0.87 |
C2orf64 | 0.87 | 0.78 |
C1orf57 | 0.86 | 0.79 |
PTS | 0.86 | 0.86 |
PPA2 | 0.86 | 0.79 |
NDUFA9 | 0.86 | 0.79 |
NDUFA4 | 0.85 | 0.78 |
SDHB | 0.85 | 0.81 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SMTN | -0.52 | -0.69 |
SLC19A1 | -0.51 | -0.55 |
SEMA4B | -0.50 | -0.60 |
DMPK | -0.50 | -0.60 |
HIP1R | -0.50 | -0.55 |
TNKS1BP1 | -0.49 | -0.48 |
GLIS2 | -0.48 | -0.59 |
CRIPAK | -0.48 | -0.59 |
HDAC7 | -0.48 | -0.63 |
MYO9B | -0.47 | -0.53 |
Section III. Gene Ontology annotation
Molecular function | 去term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
Biological process | 去term | Evidence | Neuro keywords | PubMed ID |
GO:0007158 | neuron adhesion | TAS | neuron (GO term level: 5) | 9226371 |
GO:0007155 | cell adhesion | IEA | - | |
GO:0007166 | cell surface receptor linked signal transduction | IEA | - | |
GO:0034109 | homotypic cell-cell adhesion | IEA | - | |
GO:0050850 | positive regulation of calcium-mediated signaling | IEA | - | |
Cellular component | 去term | Evidence | Neuro keywords | PubMed ID |
GO:0030424 | axon | IEA | neuron, axon, Neurotransmitter (GO term level: 6) | - |
GO:0016021 | integral to membrane | TAS | 9226371 | |
GO:0009897 | external side of plasma membrane | IEA | - | |
GO:0005886 | plasma membrane | TAS | 9226371 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CELL ADHESION MOLECULES CAMS | 134 | 93 | All SZGR 2.0 genes in this pathway |
KEGG PRION DISEASES | 35 | 28 | All SZGR 2.0 genes in this pathway |
DEURIG T细胞PROLYMPHOCYTIC白血病 | 368 | 234 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN | 275 | 168 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 2 UP | 139 | 83 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 2 UP | 30 | 24 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
YEGNASUBRAMANIAN PROSTATE CANCER | 128 | 60 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE DN | 264 | 159 | All SZGR 2.0 genes in this pathway |
FRASOR RESPONSE TO SERM OR FULVESTRANT UP | 24 | 14 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP | 397 | 206 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 4 | 110 | 66 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-125/351 | 494 | 500 | 1A | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-495 | 203 | 209 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.