Gene Page:NDN

Summary?
GeneID 4692
Symbol NDN
Synonyms HsT16328|PWCR
Description necdin, MAGE family member
Reference MIM:602117|HGNC:HGNC:7675|Ensembl:ENSG00000182636|HPRD:03667|Vega:OTTHUMG00000129161
Gene type protein-coding
Map location 15q11.2
Pascal p-value 0.648
Sherlock p-value 0.65
Fetal beta -0.054
eGene Meta

Gene in Data Sources
Gene set name Method of gene set Description Info
CNV:YES Copy number variation studies Manual curation
CV:PGCnp Genome-wide Association Study GWAS
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 6

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
NHP2 0.87 0.85
MRPS24 0.84 0.79
C12orf10 0.83 0.80
AC174470.1 0.83 0.79
GADD45GIP1 0.83 0.80
TOMM5 0.83 0.81
RABAC1 0.82 0.78
POP7 0.82 0.79
EXOSC4 0.82 0.81
CCDC56 0.82 0.79
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.26 -0.61 -0.61
AF347015.2 -0.58 -0.57
AF347015.15 -0.57 -0.58
AF347015.33 -0.57 -0.58
MT-CYB -0.56 -0.57
AF347015.8 -0.56 -0.56
MT-CO2 -0.52 -0.51
AF347015.18 -0.51 -0.54
AF347015.9 -0.51 -0.56
FAM38A -0.51 -0.52

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003677 DNA binding IEA -
GO:0005515 protein binding 新闻学会 17353931
GO:0043015 gamma-tubulin binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007417 central nervous system development IEA Brain (GO term level: 6) -
GO:0007413 axonal fasciculation IEA neuron, axon (GO term level: 13) -
GO:0001764 neuron migration IEA neuron (GO term level: 8) -
GO:0048676 axon extension involved in development IEA axon (GO term level: 14) -
GO:0048666 neuron development IEA neuron (GO term level: 9) -
GO:0008347 glial cell migration IEA neuron, Glial (GO term level: 8) -
GO:0001558 regulation of cell growth IEA -
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006350 transcription IEA -
GO:0008285 negative regulation of cell proliferation TAS 9630521
GO:0007585 respiratory gaseous exchange IEA -
GO:0048011 nerve growth factor receptor signaling pathway IEA -
GO:0019233 sensory perception of pain IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005813 centrosome IEA -
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -
GO:0043204 perikaryon IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ARSE CDPX | CDPX1 | CDPXR | MGC163310 arylsulfatase E (chondrodysplasia punctata 1) Two-hybrid BioGRID 16169070
AUP1 - ancient ubiquitous protein 1 Affinity Capture-MS BioGRID 17353931
DHCR7 SLOS 7-dehydrocholesterol reductase Affinity Capture-MS BioGRID 17353931
E2F1 E2F-1 | RBAP1 | RBBP3 | RBP3 E2F transcription factor 1 - HPRD,BioGRID 9422723|14593116
E2F4 E2F-4 E2F transcription factor 4, p107/p130-binding - HPRD 12198120
HNRNPU HNRPU | SAF-A | U21.1 heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) - HPRD,BioGRID 11813259
IL1A IL-1A | IL1 | IL1-ALPHA | IL1F1 interleukin 1, alpha - HPRD,BioGRID 12913118
LASS2 CerS2 | FLJ10243 | L3 | MGC987 | SP260 | TMSG1 LAG1 homolog, ceramide synthase 2 Affinity Capture-MS BioGRID 17353931
NDN HsT16328 | PWCR necdin homolog (mouse) - HPRD 12414813
NDN HsT16328 | PWCR necdin homolog (mouse) Two-hybrid BioGRID 10915798
NGFR CD271 | Gp80-LNGFR | TNFRSF16 | p75(NTR) | p75NTR nerve growth factor receptor (TNFR superfamily, member 16) - HPRD,BioGRID 12414813|12716928
|14593116
NUBP1 MGC117406 | MGC130052 | MGC130053 | NBP | NBP1 nucleotide binding protein 1 (MinD homolog, E. coli) - HPRD,BioGRID 10915798
NUCB2 NEFA nucleobindin 2 - HPRD,BioGRID 10915798
PJA1 RNF70 praja 1 - HPRD,BioGRID 11959851
RPS11 - 核糖体蛋白S11 Affinity Capture-MS BioGRID 17353931
SEC61A1 HSEC61 | SEC61 | SEC61A Sec61 alpha 1 subunit (S. cerevisiae) Affinity Capture-MS BioGRID 17353931
SRPRB APMCF1 signal recognition particle receptor, B subunit Affinity Capture-MS BioGRID 17353931
TMEM33 1600019D15Rik | FLJ10525 | SHINC3 transmembrane protein 33 Affinity Capture-MS BioGRID 17353931
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 - HPRD,BioGRID 10347180


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID P75 NTR PATHWAY 69 51 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN 526 357 All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP 351 230 All SZGR 2.0 genes in this pathway
CASORELLI急性PROMYELOCYTIC LEUKEMIA DN 663 425 All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL DN 86 59 All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN 291 176 All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP 316 190 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP DN 199 124 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP 238 135 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK DN 196 131 All SZGR 2.0 genes in this pathway
WONG ENDMETRIUM CANCER DN 82 53 All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION APOBEC2 27 19 All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 12HR 43 35 All SZGR 2.0 genes in this pathway
JOHANSSON BRAIN CANCER EARLY VS LATE DN 45 35 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM4 261 153 All SZGR 2.0 genes in this pathway
GARCIA TARGETS OF FLI1 AND DAX1 DN 176 104 All SZGR 2.0 genes in this pathway
FRIDMAN SENESCENCE UP 77 60 All SZGR 2.0 genes in this pathway
FRIDMAN IMMORTALIZATION DN 34 24 All SZGR 2.0 genes in this pathway
KANNAN TP53 TARGETS UP 58 40 All SZGR 2.0 genes in this pathway
PEART HDAC PROLIFERATION CLUSTER UP 57 35 All SZGR 2.0 genes in this pathway
POMEROY MEDULLOBLASTOMA PROGNOSIS UP 47 30 All SZGR 2.0 genes in this pathway
GUO HEX TARGETS UP 81 54 All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS DN 234 137 All SZGR 2.0 genes in this pathway
PAL PRMT5 TARGETS UP 203 135 All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION MUSCLE UP 43 33 All SZGR 2.0 genes in this pathway
LEE AGING MUSCLE DN 46 29 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR 681 420 All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP 113 71 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
KRASNOSELSKAYA ILF3 TARGETS DN 46 38 All SZGR 2.0 genes in this pathway
TSENG ADIPOGENIC POTENTIAL UP 30 19 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566 371 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN 353 226 All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING 510 309 All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE DN 108 68 All SZGR 2.0 genes in this pathway
SCHRAETS MLL TARGETS UP 35 21 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN 435 289 All SZGR 2.0 genes in this pathway
LEE INTRATHYMIC T PROGENITOR 21 14 All SZGR 2.0 genes in this pathway
COLINA TARGETS OF 4EBP1 AND 4EBP2 356 214 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP 207 143 All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP 166 105 All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721 492 All SZGR 2.0 genes in this pathway
NAKAYAMA SOFT TISSUE TUMORS PCA1 DN 74 47 All SZGR 2.0 genes in this pathway
金所有障碍少突细胞NUMBER CORR UP 756 494 All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP 548 370 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP 504 321 All SZGR 2.0 genes in this pathway
BRIDEAU IMPRINTED GENES 63 47 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-200bc/429 92 98 m8 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
miR-217 90 96 1A hsa-miR-217 UACUGCAUCAGGAACUGAUUGGAU