Gene Page:ATM

Summary?
GeneID 472
Symbol ATM
Synonyms AT1|ATA|ATC|ATD|ATDC|ATE|TEL1|TELO1
Description ATM serine/threonine kinase
Reference MIM:607585|HGNC:HGNC:795|Ensembl:ENSG00000149311|HPRD:06347|Vega:OTTHUMG00000166480
Gene type protein-coding
地图上的位置 11q22-q23
Pascal p-value 0.768
Sherlock p-value 0.543
Fetal beta 1.15
Support INTRACELLULAR SIGNAL TRANSDUCTION
Ascano FMRP targets

Gene in Data Sources
Gene set name 基因的方法设置 Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.006
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0817

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
ROBLD3 0.88 0.85
CCDC56 0.85 0.81
MRPL36 0.85 0.78
PRELID1 0.83 0.77
PSMB3 0.82 0.80
RNF181 0.82 0.83
MRPL20 0.81 0.73
GABARAP 0.81 0.77
PSMB6 0.81 0.84
RNF7 0.81 0.77
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MT-ATP8 -0.42 -0.46
AF347015.18 -0.40 -0.44
COBLL1 -0.40 -0.40
PTRF -0.40 -0.42
MYH9 -0.39 -0.37
AF347015.26 -0.39 -0.43
EPAS1 -0.39 -0.41
GIMAP8 -0.38 -0.40
AF347015.2 -0.38 -0.40
FLT1 -0.37 -0.42

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0003677 DNA binding IEA -
GO:0004674 protein serine/threonine kinase activity IDA 11375976
GO:0016740 transferase activity IEA -
GO:0016303 1-phosphatidylinositol-3-kinase activity IMP 11375976
GO:0047485 protein N-terminus binding IDA 11375976
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007420 brain development IEA Brain (GO term level: 7) -
GO:0051402 neuron apoptosis IEA neuron, axon, dendrite (GO term level: 7) -
GO:0000077 DNA damage checkpoint IEA -
GO:0001756 somitogenesis IEA -
GO:0007131 reciprocal meiotic recombination TAS 7792600
GO:0006468 protein amino acid phosphorylation IEA -
GO:0008219 cell death IEA -
GO:0007292 female gamete generation IEA -
GO:0006281 DNA repair IEA -
GO:0006281 DNA repair TAS 9733515
GO:0007165 signal transduction TAS 7792600
GO:0008630 DNA damage response, signal transduction resulting in induction of apoptosis IEA -
GO:0007094 mitotic cell cycle spindle assembly checkpoint IMP 11943150
GO:0007507 heart development IEA -
GO:0010212 response to ionizing radiation IDA 11375976
GO:0045786 negative regulation of cell cycle IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005819 spindle IEA -
GO:0005634 nucleus IEA -
GO:0005654 nucleoplasm EXP 10550055|10959836|11331603
|12556884|12607003
GO:0031410 cytoplasmic vesicle IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ABL1 ABL | JTK7 | bcr/abl | c-ABL | p150 | v-abl c-abl oncogene 1, receptor tyrosine kinase - HPRD,BioGRID 9168117
AP1B1 ADTB1 | AP105A | BAM22 | CLAPB2 一个daptor-related protein complex 1, beta 1 subunit Protein-peptide BioGRID 10608806
AP2A2 ADTAB | CLAPA2 | HIP9 | HYPJ 一个daptor-related protein complex 2, alpha 2 subunit Protein-peptide BioGRID 10608806
AP2B1 ADTB2 | AP105B | AP2-BETA | CLAPB1 | DKFZp781K0743 一个daptor-related protein complex 2, beta 1 subunit - HPRD 9707615
AP3B2 DKFZp686D17136 | NAPTB 一个daptor-related protein complex 3, beta 2 subunit - HPRD 9707615
ATF2 CRE-BP1 | CREB2 | HB16 | MGC111558 | TREB7 一个ctivating transcription factor 2 An unspecified isoform of ATM interacts with and phosphorylates ATF2. BIND 15916964
ATM AT1 | ATA | ATC | ATD | ATDC | ATE | DKFZp781A0353 | MGC74674 | TEL1 | TELO1 共济失调telangiectasia mutated Protein-peptide BioGRID 10608806
ATM AT1 | ATA | ATC | ATD | ATDC | ATE | DKFZp781A0353 | MGC74674 | TEL1 | TELO1 共济失调telangiectasia mutated ATM interacts with itself to form a dimer. BIND 15790808
ATR FRP1 | MEC1 | SCKL | SCKL1 共济失调telangiectasia and Rad3 related Protein-peptide BioGRID 10608806
BLM BS | MGC126616 | MGC131618 | MGC131620 | RECQ2 | RECQL2 | RECQL3 Bloom syndrome Affinity Capture-Western
Co-purification
Reconstituted Complex		 BioGRID 10783165|12034743
BRCA1 BRCAI | BRCC1 | IRIS | PSCP | RNF53 breast cancer 1, early onset Affinity Capture-Western
Co-purification
Protein-peptide
Reconstituted Complex		 BioGRID 10550055|10608806
|10783165|10866324
|11016625|11114888
|11278964
BRCA1 BRCAI | BRCC1 | IRIS | PSCP | RNF53 breast cancer 1, early onset - HPRD 2001833
BRCA2 BRCC2 | FACD | FAD | FAD1 | FANCB | FANCD | FANCD1 breast cancer 2, early onset Reconstituted Complex BioGRID 15199141
CAT MGC138422 | MGC138424 catalase - HPRD 10567403
CHEK1 CHK1 CHK1 checkpoint homolog (S. pombe) Protein-peptide BioGRID 10608806
CHEK2 CDS1 | CHK2 | HuCds1 | LFS2 | PP1425 | RAD53 CHK2 checkpoint homolog (S. pombe) ATM phosphorylates Chk2 at threonine 68. BIND 15790808
CHEK2 CDS1 | CHK2 | HuCds1 | LFS2 | PP1425 | RAD53 CHK2 checkpoint homolog (S. pombe) ATM phosphorylates Chk2 at threonine 68. BIND 15064416
CREB1 CREB | MGC9284 cAMP responsive element binding protein 1 Affinity Capture-Western BioGRID 15073328
E4F1 E4F | MGC99614 E4F transcription factor 1 Protein-peptide BioGRID 10608806
EEF1E1 AIMP3 | P18 eukaryotic translation elongation factor 1 epsilon 1 p18 interacts with ATM. BIND 15680327
EIF4EBP1 4E-BP1 | 4EBP1 | BP-1 | MGC4316 | PHAS-I eukaryotic translation initiation factor 4E binding protein 1 Protein-peptide BioGRID 10608806
FANCD2 DKFZp762A223 | FA-D2 | FA4 | FACD | FAD | FAD2 | FANCD | FLJ23826 Fanconi anemia, complementation group D2 Affinity Capture-Western
Reconstituted Complex
Two-hybrid		 BioGRID 12086603|14499622
H2AFX H2A.X | H2A/X | H2AX H2A histone family, member X ATM phosphorylates the carboxy terminus of H2AX. BIND 15064416
HINT1 FLJ30414 | FLJ32340 | HINT | PKCI-1 | PRKCNH1 histidine triad nucleotide binding protein 1 - HPRD 7644499
LIG4 - ligase IV, DNA, ATP-dependent Protein-peptide BioGRID 10608806
MCM2 BM28 | CCNL1 | CDCL1 | D3S3194 | KIAA0030 | MGC10606 | MITOTIN | cdc19 minichromosome maintenance complex component 2 Biochemical Activity BioGRID 15210935
MDC1 DKFZp781A0122 | KIAA0170 | MGC166888 | NFBD1 mediator of DNA damage checkpoint 1 - HPRD 12607005
MDC1 DKFZp781A0122 | KIAA0170 | MGC166888 | NFBD1 mediator of DNA damage checkpoint 1 Affinity Capture-Western BioGRID 14519663
MLH1 COCA2 | FCC2 | HNPCC | HNPCC2 | MGC5172 | hMLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) Co-purification BioGRID 10783165
MRE11A ATLD | HNGS1 | MRE11 | MRE11B MRE11 meiotic recombination 11 homolog A (S. cerevisiae) ATM interacts with MRE11A (Mre11). BIND 15758953
MRE11A ATLD | HNGS1 | MRE11 | MRE11B MRE11 meiotic recombination 11 homolog A (S. cerevisiae) Co-purification
Protein-peptide		 BioGRID 10608806|10783165
MSH2 COCA1 | FCC1 | HNPCC | HNPCC1 | LCFS2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) Co-purification BioGRID 10783165
MSH6 GTBP | HNPCC5 | HSAP mutS homolog 6 (E. coli) Co-purification BioGRID 10783165
NBN AT-V1 | AT-V2 | ATV | FLJ10155 | MGC87362 | NBS | NBS1 | P95 nibrin Co-purification
Protein-peptide		 BioGRID 10608806|10783165
NBN AT-V1 | AT-V2 | ATV | FLJ10155 | MGC87362 | NBS | NBS1 | P95 nibrin NBS1 interacts with ATM. BIND 15758953
PEX5 FLJ50634 | FLJ50721 | FLJ51948 | PTS1-BP | PTS1R | PXR1 peroxisomal biogenesis factor 5 - HPRD,BioGRID 10567403
PRKDC DNA-PKcs | DNAPK | DNPK1 | HYRC | HYRC1 | XRCC7 | p350 protein kinase, DNA-activated, catalytic polypeptide - HPRD,BioGRID 10464290
PTS FLJ97081 | PTPS 6-pyruvoyltetrahydropterin synthase Protein-peptide BioGRID 10608806
RAD17 CCYC | FLJ41520 | HRAD17 | R24L | RAD17SP | RAD24 RAD17 homolog (S. pombe) - HPRD,BioGRID 11418864
RAD50 RAD50-2 | hRad50 RAD50 homolog (S. cerevisiae) Co-purification BioGRID 10783165
RAD51 BRCC5 | HRAD51 | HsRad51 | HsT16930 | RAD51A | RECA RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) Affinity Capture-Western BioGRID 10212258
RBBP8 CTIP | RIM retinoblastoma binding protein 8 Affinity Capture-Western
Protein-peptide
Reconstituted Complex		 BioGRID 10608806|10910365
RFC1 A1 | MGC51786 | MHCBFB | PO-GA | RECC1 | RFC | RFC140 replication factor C (activator 1) 1, 145kDa Co-purification BioGRID 10783165
RHEB MGC111559 | RHEB2 Ras homolog enriched in brain Affinity Capture-Western
Reconstituted Complex		 BioGRID 15854902
RHEB MGC111559 | RHEB2 Ras homolog enriched in brain ATM interacts with Rheb. BIND 15854902
SMC1A CDLS2 | DKFZp686L19178 | DXS423E | KIAA0178 | MGC138332 | SB1.8 | SMC1 | SMC1L1 | SMC1alpha | SMCB structural maintenance of chromosomes 1A Affinity Capture-Western
Reconstituted Complex		 BioGRID 11877376
TERF1 FLJ41416 | PIN2 | TRBF1 | TRF | TRF1 | hTRF1-AS | t-TRF1 telomeric repeat binding factor (NIMA-interacting) 1 - HPRD,BioGRID 11375976
TIPARP DDF1 | DKFZp434J214 | DKFZp686N0351 | DKFZp686P1838 | FLJ40466 | PARP-1 | PARP-7 | PARP7 TCDD-inducible poly(ADP-ribose) polymerase - HPRD 11238919
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 - HPRD,BioGRID 9843217
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 ATM phosphorylates p53 at serine 15. BIND 15064416
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 An unspecified isoform of ATM interacts with and phosphorylates p53. This interaction was modeled on a demonstrated interaction between human ATM and p53 from an unspecified species. BIND 15916964
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 ATM phosphorylates p53 at Ser15. BIND 15175154
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 ATM phosphorylates p53 at serine 15. BIND 15790808
TP53BP1 53BP1 | FLJ41424 | MGC138366 | p202 tumor protein p53 binding protein 1 Biochemical Activity
Reconstituted Complex		 BioGRID 12447390|12697768
UPF1 FLJ43809 | FLJ46894 | HUPF1 | KIAA0221 | NORF1 | RENT1 | pNORF1 UPF1 regulator of nonsense transcripts homolog (yeast) ATM phosphorylates hUpf1. BIND 15175154
WRN DKFZp686C2056 | RECQ3 | RECQL2 | RECQL3 Werner syndrome Protein-peptide BioGRID 10608806
XRCC5 FLJ39089 | KARP-1 | KARP1 | KU80 | KUB2 | Ku86 | NFIV X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) XRCC5 (Ku80) interacts with ATM. BIND 15758953


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG CELL CYCLE 128 84 All SZGR 2.0 genes in this pathway
KEGG P53 SIGNALING PATHWAY 69 45 All SZGR 2.0 genes in this pathway
KEGG APOPTOSIS 88 62 All SZGR 2.0 genes in this pathway
BIOCARTA CHEMICAL PATHWAY 22 15 All SZGR 2.0 genes in this pathway
BIOCARTA ATM PATHWAY 20 16 All SZGR 2.0 genes in this pathway
BIOCARTA G1 PATHWAY 28 21 All SZGR 2.0 genes in this pathway
BIOCARTA G2 PATHWAY 24 20 All SZGR 2.0 genes in this pathway
BIOCARTA P53HYPOXIA PATHWAY 23 21 All SZGR 2.0 genes in this pathway
BIOCARTA P53 PATHWAY 16 13 All SZGR 2.0 genes in this pathway
BIOCARTA RB PATHWAY 13 11 All SZGR 2.0 genes in this pathway
BIOCARTA ATRBRCA PATHWAY 21 12 All SZGR 2.0 genes in this pathway
PID FANCONI PATHWAY 47 28 All SZGR 2.0 genes in this pathway
PID P38 MKK3 6PATHWAY 26 21 All SZGR 2.0 genes in this pathway
PID NFKAPPAB CANONICAL PATHWAY 23 20 All SZGR 2.0 genes in this pathway
PID E2F PATHWAY 74 48 All SZGR 2.0 genes in this pathway
PID ATM PATHWAY 34 25 All SZGR 2.0 genes in this pathway
PID TELOMERASE PATHWAY 68 48 All SZGR 2.0 genes in this pathway
PID DELTA NP63 PATHWAY 47 34 All SZGR 2.0 genes in this pathway
PID BARD1 PATHWAY 29 19 All SZGR 2.0 genes in this pathway
PID P53 REGULATION PATHWAY 59 50 All SZGR 2.0 genes in this pathway
REACTOME MEIOSIS 116 81 All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE 421 253 All SZGR 2.0 genes in this pathway
REACTOME P53 INDEPENDENT G1 S DNA DAMAGE CHECKPOINT 51 31 All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE CHECKPOINTS 124 70 All SZGR 2.0 genes in this pathway
REACTOME HOMOLOGOUS RECOMBINATION REPAIR OF REPLICATION INDEPENDENT DOUBLE STRAND BREAKS 17 11 All SZGR 2.0 genes in this pathway
REACTOME P53 DEPENDENT G1 DNA DAMAGE RESPONSE 57 35 All SZGR 2.0 genes in this pathway
REACTOME FANCONI ANEMIA PATHWAY 25 11 All SZGR 2.0 genes in this pathway
REACTOME双链断裂修复 24 14 All SZGR 2.0 genes in this pathway
REACTOME AUTODEGRADATION OF THE E3 UBIQUITIN LIGASE COP1 51 30 All SZGR 2.0 genes in this pathway
REACTOME DNA REPAIR 112 59 All SZGR 2.0 genes in this pathway
REACTOME MEIOTIC RECOMBINATION 86 62 All SZGR 2.0 genes in this pathway
REACTOME G2 M CHECKPOINTS 45 23 All SZGR 2.0 genes in this pathway
REACTOME G2 M DNA DAMAGE CHECKPOINT 12 8 All SZGR 2.0 genes in this pathway
WINTER HYPOXIA DN 52 30 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP 783 507 All SZGR 2.0 genes in this pathway
ZHONG RESPONSE TO AZACITIDINE AND TSA DN 70 38 All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN 320 184 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN 460 312 All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN 384 230 All SZGR 2.0 genes in this pathway
WIKMAN ASBESTOS LUNG CANCER DN 28 13 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP 276 165 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP 341 197 All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR DN 64 39 All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR DN 75 50 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP 584 356 All SZGR 2.0 genes in this pathway
OUELLET CULTURED OVARIAN CANCER INVASIVE VS LMP DN 35 20 All SZGR 2.0 genes in this pathway
RAMJAUN APOPTOSIS BY TGFB1 VIA SMAD4 DN 8 6 All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN 800 473 All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 23 24 13 All SZGR 2.0 genes in this pathway
SCHEIDEREIT IKK INTERACTING PROTEINS 58 45 All SZGR 2.0 genes in this pathway
SCHRAMM INHBA TARGETS DN 24 12 All SZGR 2.0 genes in this pathway
CALVET IRINOTECAN SENSITIVE VS RESISTANT UP 5 5 All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK 101 73 All SZGR 2.0 genes in this pathway
PUJANA XPRSS INT NETWORK 168 103 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK 779 480 All SZGR 2.0 genes in this pathway
PUJANA BRCA CENTERED NETWORK 117 72 All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS 775 494 All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPAIR GENES 230 137 All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED SIGNIFICANTLY 26 22 All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER DN 160 110 All SZGR 2.0 genes in this pathway
CHEOK RESPONSE TO HD MTX UP 23 13 All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH 11Q23 DELETION 23 18 All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR 293 193 All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION 405 264 All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP 249 170 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022 619 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING DN 36 24 All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469 239 All SZGR 2.0 genes in this pathway
GALI TP53 TARGETS APOPTOTIC UP 8 7 All SZGR 2.0 genes in this pathway
MATZUK MEIOTIC AND DNA REPAIR 39 26 All SZGR 2.0 genes in this pathway
MATZUK SPERMATOCYTE 72 55 All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP 323 240 All SZGR 2.0 genes in this pathway
LEE EARLY T LYMPHOCYTE DN 57 36 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR DN 185 116 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN 277 166 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS DN 89 50 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN 442 275 All SZGR 2.0 genes in this pathway
COLINA TARGETS OF 4EBP1 AND 4EBP2 356 214 All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE DN 181 97 All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED 351 238 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S2 115 74 All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC 1103 714 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP 430 288 All SZGR 2.0 genes in this pathway
KRIEG KDM3A TARGETS NOT HYPOXIA 208 107 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-203.1 2297 2303 1A hsa-miR-203 UGAAAUGUUUAGGACCACUAG