Gene Page:NKX2-2
Summary?
GeneID | 4821 |
Symbol | NKX2-2 |
Synonyms | NKX2.2|NKX2B |
Description | NK2 homeobox 2 |
Reference | MIM:604612|HGNC:HGNC:7835|Ensembl:ENSG00000125820|HPRD:05213|Vega:OTTHUMG00000170524 |
Gene type | protein-coding |
Map location | 20p11.22 |
Pascal p-value | 0.001 |
Sherlock p-value | 0.173 |
Fetal beta | -1.914 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | 系统的搜索PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 5 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6448932 | chr4 | 12595798 | NKX2-2 | 4821 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/NKX2-2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
CORT | 0.69 | 0.71 |
APITD1 | 0.68 | 0.69 |
EXOC3L | 0.65 | 0.48 |
LRRC56 | 0.64 | 0.69 |
PLCB2 | 0.63 | 0.66 |
KRTCAP3 | 0.61 | 0.33 |
WFDC2 | 0.59 | 0.58 |
RPP25 | 0.59 | 0.59 |
RXRG | 0.59 | 0.31 |
CASZ1 | 0.58 | 0.44 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NET1 | -0.31 | -0.33 |
AF347015.2 | -0.30 | -0.25 |
AF347015.26 | -0.29 | -0.29 |
AF347015.15 | -0.28 | -0.25 |
MT-CYB | -0.28 | -0.25 |
PREX2 | -0.27 | -0.30 |
AF347015.8 | -0.27 | -0.23 |
PITPNC1 | -0.27 | -0.26 |
PTRF | -0.27 | -0.23 |
EGLN3 | -0.26 | -0.23 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0007420 | brain development | TAS | Brain (GO term level: 7) | 1346742 |
GO:0048665 | neuron fate specification | IEA | neuron (GO term level: 10) | - |
GO:0014003 | 少突细胞development | IEA | axon, oligodendrocyte, Glial (GO term level: 10) | - |
GO:0021529 | spinal cord oligodendrocyte cell differentiation | IEA | neuron, axon, oligodendrocyte (GO term level: 10) | - |
GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0048468 | cell development | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0031018 | endocrine pancreas development | IEA | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
GO:0045597 | positive regulation of cell differentiation | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005730 | nucleolus | IDA | 18029348 | |
GO:0005737 | cytoplasm | IDA | 18029348 |
部分诉通路注释
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MATURITY ONSET DIABETES OF THE YOUNG | 25 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF BETA CELL DEVELOPMENT | 30 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF GENE EXPRESSION IN BETA CELLS | 20 | 15 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN | 161 | 105 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
ZHOU PANCREATIC ENDOCRINE PROGENITOR | 14 | 11 | All SZGR 2.0 genes in this pathway |
ZHOU PANCREATIC BETA CELL | 11 | 9 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP | 259 | 159 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 | 227 | 149 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-17-5p/20/93.mr/106/519.d | 441 | 447 | 1A | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-182 | 574 | 581 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-30-5p | 253 | 260 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-363 | 714 | 720 | 1A | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
miR-369-3p | 97 | 103 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 97 | 104 | 1A,m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-377 | 394 | 400 | m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-452 | 715 | 722 | 1A,m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
miR-543 | 261 | 267 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
miR-96 | 575 | 581 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.