Gene Page:NMB

Summary?
GeneID 4828
Symbol NMB
Synonyms -
Description neuromedin B
Reference MIM:162340|HGNC:HGNC:7842|Ensembl:ENSG00000197696|HPRD:01210|Vega:OTTHUMG00000148666
Gene type protein-coding
Map location 15q22-qter
Pascal p-value 9.326E-9
Sherlock p-value 0.525
Fetal beta -0.45
eGene Myers' cis & trans
元

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed的基因co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs9460922 chr6 10601665 NMB 4828 0.04 trans
rs17111364 chr10 97901813 NMB 4828 0.17 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005179 hormone activity TAS 2458345
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007218 neuropeptide signaling pathway IEA Neurotransmitter (GO term level: 8) -
GO:0007267 cell-cell signaling TAS 2458345
GO:0007165 signal transduction TAS 2458345
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005625 soluble fraction TAS 2458345

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK 205 136 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME PEPTIDE LIGAND BINDING RECEPTORS 188 108 All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS 305 177 All SZGR 2.0 genes in this pathway
REACTOME G ALPHA Q SIGNALLING EVENTS 184 116 All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805 368 All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408 246 All SZGR 2.0 genes in this pathway
KIM RESPONSE TO TSA AND DECITABINE UP 129 73 All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL UP 276 187 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
SCIBETTA KDM5B TARGETS DN 81 55 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537 339 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP 443 294 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL DN 186 107 All SZGR 2.0 genes in this pathway
DACOSTA ERCC3 ALLELE XPCS VS TTD UP 28 19 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN 637 377 All SZGR 2.0 genes in this pathway
LIU LIVER CANCER 38 18 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP 176 115 All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648 385 All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER METASTASIS DN 121 65 All SZGR 2.0 genes in this pathway
LENAOUR DENDRITIC CELL MATURATION DN 128 90 All SZGR 2.0 genes in this pathway
LEE AGING NEOCORTEX DN 80 49 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP 390 242 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS DN 135 88 All SZGR 2.0 genes in this pathway
TSENG ADIPOGENIC POTENTIAL DN 46 28 All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 DN 240 153 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
DASU IL6 SIGNALING UP 59 44 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 182 102 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-214 81 87 m8 hsa-miR-214brain ACAGCAGGCACAGACAGGCAG