Gene Page:ATP2A2
Summary?
GeneID | 488 |
Symbol | ATP2A2 |
Synonyms | ATP2B|DAR|DD|SERCA2 |
Description | ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 |
Reference | MIM:108740|HGNC:HGNC:812|Ensembl:ENSG00000174437|HPRD:00161|Vega:OTTHUMG00000169327 |
Gene type | protein-coding |
Map location | 12q24.11 |
Pascal p-value | 5.832E-5 |
Sherlock p-value | 0.044 |
Fetal beta | -1.542 |
eGene | Cerebellum Myers' cis & trans |
Support | ION BALANCE G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:PGC128 | Genome-wide Association Study | A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
CV:PGC128
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|---|---|---|---|---|---|---|
rs4766428 | chr12 | 110723245 | TC | 7.093E-10 | intronic | ATP2A2 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10994209 | chr10 | 61877705 | ATP2A2 | 488 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/ATP2A2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
KCNB1 | 0.94 | 0.94 |
SCN8A | 0.93 | 0.92 |
CNNM1 | 0.93 | 0.91 |
GRIN2A | 0.92 | 0.74 |
AP000751.3 | 0.91 | 0.90 |
PLCB1 | 0.91 | 0.88 |
KCNMA1 | 0.91 | 0.87 |
SLC6A17 | 0.91 | 0.93 |
DLGAP2 | 0.90 | 0.86 |
GABRB2 | 0.90 | 0.89 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RAB13 | -0.46 | -0.61 |
BCL7C | -0.45 | -0.50 |
DBI | -0.43 | -0.58 |
PECI | -0.42 | -0.49 |
EFEMP2 | -0.42 | -0.42 |
GTF3C6 | -0.42 | -0.38 |
RAB34 | -0.42 | -0.51 |
AC006276.2 | -0.41 | -0.40 |
C9orf46 | -0.40 | -0.39 |
C21orf57 | -0.40 | -0.41 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0048155 | S100 alpha binding | 新闻学会 | astrocyte (GO term level: 4) | 12804600 |
GO:0000166 | nucleotide binding | IEA | - | |
GO:0000287 | magnesium ion binding | IEA | - | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0005388 | calcium-transporting ATPase activity | TAS | 2844796 | |
GO:0016787 | hydrolase activity | IEA | - | |
GO:0016820 | 水解酶活性,作用于酸anhydrides, catalyzing transmembrane movement of substances | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007155 | cell adhesion | TAS | 10080178 | |
GO:0008544 | epidermis development | TAS | 10080178 | |
GO:0008152 | metabolic process | IEA | - | |
GO:0006816 | calcium ion transport | IEA | - | |
GO:0006812 | cation transport | IEA | - | |
GO:0015992 | proton transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005792 | microsome | TAS | 2844796 | |
GO:0005624 | membrane fraction | TAS | 2844796 | |
GO:0016020 | membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 2844796 | |
GO:0033017 | sarcoplasmic reticulum membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
KEGG CARDIAC MUSCLE CONTRACTION | 80 | 51 | All SZGR 2.0 genes in this pathway |
KEGG ALZHEIMERS DISEASE | 169 | 110 | All SZGR 2.0 genes in this pathway |
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM | 85 | 65 | All SZGR 2.0 genes in this pathway |
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC | 76 | 59 | All SZGR 2.0 genes in this pathway |
KEGG DILATED CARDIOMYOPATHY | 92 | 68 | All SZGR 2.0 genes in this pathway |
REACTOME PRE NOTCH EXPRESSION AND PROCESSING | 44 | 24 | All SZGR 2.0 genes in this pathway |
REACTOME PRE NOTCH PROCESSING IN GOLGI | 16 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET HOMEOSTASIS | 78 | 49 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET CALCIUM HOMEOSTASIS | 18 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME ION TRANSPORT BY P TYPE ATPASES | 34 | 21 | All SZGR 2.0 genes in this pathway |
REACTOME ION CHANNEL TRANSPORT | 55 | 42 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 DN | 281 | 186 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
由阿霉素DN GRAESSMANN细胞凋亡 | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 4 | 61 | 34 | All SZGR 2.0 genes in this pathway |
SCHLOSSER MYC TARGETS AND SERUM RESPONSE UP | 47 | 32 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
JOHANSSON BRAIN CANCER EARLY VS LATE DN | 45 | 35 | All SZGR 2.0 genes in this pathway |
HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER PROGRESSION G1 G2 DN | 25 | 18 | All SZGR 2.0 genes in this pathway |
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE DN | 121 | 79 | All SZGR 2.0 genes in this pathway |
PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
KLEIN PRIMARY EFFUSION LYMPHOMA UP | 51 | 29 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
MODY HIPPOCAMPUS POSTNATAL | 63 | 50 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D4 | 55 | 37 | All SZGR 2.0 genes in this pathway |
JIANG AGING HYPOTHALAMUS DN | 40 | 31 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION NEOCORTEX DN | 88 | 58 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
KAAB FAILED HEART VENTRICLE DN | 41 | 28 | All SZGR 2.0 genes in this pathway |
JIANG AGING CEREBRAL CORTEX DN | 54 | 43 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO GONADOTROPHINS DN | 87 | 66 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN UP | 90 | 58 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
KASLER HDAC7 TARGETS 1 UP | 194 | 133 | All SZGR 2.0 genes in this pathway |
IKEDA MIR30 TARGETS DN | 27 | 24 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
CHEMELLO SOLEUS VS EDL MYOFIBERS UP | 35 | 16 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 490 | 497 | 1A,m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-141/200a | 265 | 271 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-148/152 | 471 | 478 | 1A,m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-149 | 308 | 314 | m8 | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
miR-181 | 357 | 363 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-182 | 778 | 784 | m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-200bc/429 | 500 | 506 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-214 | 75 | 81 | 1A | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
miR-24 | 307 | 313 | 1A | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-30-5p | 626 | 633 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-346 | 314 | 320 | 1A | hsa-miR-346brain | UGUCUGCCCGCAUGCCUGCCUCU |
miR-384 | 350 | 356 | 1A | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
miR-493-5p | 260 | 266 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
miR-544 | 669 | 676 | 1A,m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.