Gene Page:NPY1R

Summary?
GeneID 4886
Symbol NPY1R
Synonyms NPY1-R|NPYR
Description neuropeptide Y receptor Y1
Reference MIM:162641|HGNC:HGNC:7956|Ensembl:ENSG00000164128|HPRD:01215|Vega:OTTHUMG00000161371
Gene type protein-coding
Map location 4q32.2
Pascal p-value 0.362
Fetal beta -0.49
DMG 1 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search 与精神分裂症Co-occurance keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg24157598 4 164254508 NPY1R 3.026E-4 0.572 0.04 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
snp_a-2169623 0 NPY1R 4886 0.09 trans
rs16894557 chr6 28999825 NPY1R 4886 0.04 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
FAM155B 0.87 0.79
CBFA2T3 0.85 0.77
TNRC18B 0.85 0.89
KIRREL 0.84 0.84
AL139010.2 0.84 0.83
BAHCC1 0.83 0.84
ZNF512B 0.82 0.83
CACNA1H 0.82 0.81
ZNF710 0.82 0.82
ZBED1 0.82 0.83
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
C5orf53 -0.57 -0.72
ACOT13 -0.53 -0.73
S100B -0.53 -0.71
ACYP2 -0.53 -0.68
CA4 -0.52 -0.66
AF347015.31 -0.52 -0.72
COPZ2 -0.52 -0.67
HLA-F -0.52 -0.60
AF347015.27 -0.52 -0.71
B2M -0.51 -0.69

Section III. Gene Ontology annotation

分子功能 GO term Evidence Neuro keywords PubMed ID
GO:0001601 peptide YY receptor activity IEA -
GO:0001602 pancreatic polypeptide receptor activity IEA -
GO:0004872 receptor activity IEA -
GO:0005515 protein binding 新闻学会 15231747
GO:0004983 neuropeptide Y receptor activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007218 neuropeptide signaling pathway IEA Neurotransmitter (GO term level: 8) -
GO:0007187 G-protein signaling, coupled to cyclic nucleotide second messenger TAS 1317848
GO:0008217 regulation of blood pressure IEA -
GO:0007193 G-protein signaling, adenylate cyclase inhibiting pathway TAS 1321422
GO:0006006 glucose metabolic process IEA -
GO:0007165 signal transduction IEA -
GO:0007631 feeding behavior IEA -
GO:0007626 locomotory behavior IEA -
GO:0019233 sensory perception of pain IEA -
GO:0040014 regulation of multicellular organism growth IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane IEA -
GO:0005887 integral to plasma membrane TAS 1317848

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION 272 195 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME PEPTIDE LIGAND BINDING RECEPTORS 188 108 All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS 305 177 All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805 368 All SZGR 2.0 genes in this pathway
REACTOME G ALPHA I SIGNALLING EVENTS 195 114 All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408 246 All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 DN 175 82 All SZGR 2.0 genes in this pathway
WILCOX RESPONSE TO PROGESTERONE UP 152 90 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS C DN 19 11 All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL 326 213 All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN 203 134 All SZGR 2.0 genes in this pathway
WATTEL AUTONOMOUS THYROID ADENOMA DN 55 29 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
STAEGE EWING FAMILY TUMOR 33 22 All SZGR 2.0 genes in this pathway
KANG IMMORTALIZED BY TERT DN 102 67 All SZGR 2.0 genes in this pathway
LEE AGING NEOCORTEX DN 80 49 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM 302 191 All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM DN 86 66 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP 178 111 All SZGR 2.0 genes in this pathway
SASSON FSH RESPONSE 9 6 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 528 324 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 307 185 All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN 220 147 All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER HCP WITH H3K27ME3 97 72 All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN 258 160 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
MASRI RESISTANCE TO TAMOXIFEN AND AROMATASE INHIBITORS UP 20 10 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B UP 172 109 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER ERBB2 DN 5 5 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701 446 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP 260 174 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP 425 298 All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN 546 362 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP 395 249 All SZGR 2.0 genes in this pathway
POOLA INVASIVE BREAST CANCER DN 134 83 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF ICP WITH H3K4ME3 AND H3K27ME3 38 34 All SZGR 2.0 genes in this pathway
NAKAYAMA软组织涂MORS PCA2 DN 80 51 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3 137 85 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP 229 149 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP 324 193 All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 3 20 9 All SZGR 2.0 genes in this pathway
PEDERSEN TARGETS OF 611CTF ISOFORM OF ERBB2 76 45 All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP 364 236 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B 517 302 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-218 45 52 1A,m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
mir - 381 1090 1097 1A,m8 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU