Gene Page:ROR2

Summary?
GeneID 4920
Symbol ROR2
Synonyms BDB|BDB1|NTRKR2
Description receptor tyrosine kinase-like orphan receptor 2
Reference MIM:602337|HGNC:HGNC:10257|Ensembl:ENSG00000169071|HPRD:03822|Vega:OTTHUMG00000020211
Gene type protein-coding
Map location 9q22
Pascal p-value 0.004
Fetal beta -0.084
DMG 1 (# studies)
eGene Cortex
Support Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg13966448 9 94659196 ROR2 4.708E-4 -0.582 0.046 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004714 transmembrane receptor protein tyrosine kinase activity TAS neurite (GO term level: 8) 1334494
GO:0000166 nucleotide binding IEA -
GO:0004872 receptor activity IEA -
GO:0005524 ATP binding IEA -
GO:0016740 transferase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006468 protein amino acid phosphorylation IEA -
GO:0007165 signal transduction TAS 1334494
GO:0007275 multicellular organismal development TAS 1334494
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0005887 integral to plasma membrane TAS 1334494

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID WNT NONCANONICAL PATHWAY 32 26 All SZGR 2.0 genes in this pathway
PID WNT SIGNALING PATHWAY 28 23 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN 232 154 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP 238 135 All SZGR 2.0 genes in this pathway
KORKOLA YOLK SAC TUMOR 62 33 All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 2 UP 30 24 All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957 597 All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 DN 163 115 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR DN 86 62 All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 6HR 59 38 All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP 249 170 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR DN 101 70 All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 108 71 All SZGR 2.0 genes in this pathway
KRASNOSELSKAYA ILF3 TARGETS DN 46 38 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS 212 121 All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS 217 138 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC 210 123 All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC 58 43 All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871 505 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE DN 204 114 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
NAKAYAMA SOFT TISSUE TUMORS PCA2 UP 87 50 All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR DN 37 20 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN 553 343 All SZGR 2.0 genes in this pathway
DURAND STROMA S UP 297 194 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124/506 609 615 m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC