Gene Page:ATP2B4
Summary?
GeneID | 493 |
Symbol | ATP2B4 |
Synonyms | ATP2B2|MXRA1|PMCA4|PMCA4b|PMCA4x |
Description | ATPase plasma membrane Ca2+ transporting 4 |
Reference | MIM:108732|HGNC:HGNC:817|Ensembl:ENSG00000058668|HPRD:00159|Vega:OTTHUMG00000035906 |
Gene type | protein-coding |
Map location | 1q32.1 |
Fetal beta | -1.682 |
DMG | 2 (# studies) |
Support | ION BALANCE G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_PocklingtonH1 G2Cdb.human_Synaptosome G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 2 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
DNM:Awadalla_2010 | 全外显子组测序分析 | A survey of ~430 Mb of DNA from 401 synapse-expressed genes across all cases and 25 Mb of DNA in controls found 28 candidate DNMs. | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.1631 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
ATP2B4 | chr1 | 203668781 | C | T | ATP2B4:NM_001001396:exon4:c.C585T:p.N195N ATP2B4:NM_001684:exon4:c.C585T:p.N195N |
N195N | synonymous SNV | Disorganized Schizophrenia | DNM:Awadalla_2010 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg19087104 | 1 | 203643746 | ATP2B4 | 1.93E-5 | 0.28 | 0.016 | DMG:Wockner_2014 |
cg19791253 | 1 | 203595809 | ATP2B4 | -0.023 | 0.26 | DMG:Nishioka_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/ATP2B4_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0000287 | magnesium ion binding | IEA | - | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0005516 | calmodulin binding | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0005388 | calcium-transporting ATPase activity | TAS | 2137451 | |
GO:0016787 | 水解酶作用ivity | IEA | - | |
GO:0016820 | 水解酶作用ivity, acting on acid anhydrides, catalyzing transmembrane movement of substances | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008152 | metabolic process | IEA | - | |
GO:0006816 | calcium ion transport | IEA | - | |
GO:0006812 | cation transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005886 | plasma membrane | TAS | 2137451|10748016 | |
GO:0005887 | integral to plasma membrane | TAS | 2137451 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
LIU SOX4 TARGETS UP | 137 | 94 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS DN | 68 | 49 | All SZGR 2.0 genes in this pathway |
DAVICIONI RHABDOMYOSARCOMA PAX FOXO1 FUSION DN | 15 | 11 | All SZGR 2.0 genes in this pathway |
WILCOX RESPONSE TO PROGESTERONE DN | 66 | 44 | All SZGR 2.0 genes in this pathway |
PUIFFE INVASION INHIBITED BY ASCITES UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP | 177 | 110 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP | 119 | 66 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 DN | 67 | 43 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
DUNNE TARGETS OF AML1 MTG8 FUSION UP | 52 | 32 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
KIM MYC AMPLIFICATION TARGETS DN | 97 | 51 | All SZGR 2.0 genes in this pathway |
TOMLINS PROSTATE CANCER DN | 40 | 33 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
SCIAN INVERSED TARGETS OF TP53 AND TP73 DN | 31 | 23 | All SZGR 2.0 genes in this pathway |
RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
BALDWIN PRKCI TARGETS UP | 35 | 26 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE UP | 283 | 177 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
罗斯急性MYELOID LEUKEMIA CBF | 82 | 57 | All SZGR 2.0 genes in this pathway |
BROCKE APOPTOSIS REVERSED BY IL6 | 144 | 98 | All SZGR 2.0 genes in this pathway |
SWEET KRAS TARGETS UP | 84 | 51 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 16HR DN | 86 | 62 | All SZGR 2.0 genes in this pathway |
HENDRICKS SMARCA4 TARGETS UP | 56 | 35 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR DN | 148 | 102 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
KUNINGER IGF1 VS PDGFB TARGETS UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
BILD MYC ONCOGENIC SIGNATURE | 206 | 117 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
DAIRKEE CANCER PRONE RESPONSE E2 | 28 | 21 | All SZGR 2.0 genes in this pathway |
HUANG FOXA2 TARGETS DN | 36 | 21 | All SZGR 2.0 genes in this pathway |
IZADPANAH STEM CELL ADIPOSE VS BONE DN | 108 | 68 | All SZGR 2.0 genes in this pathway |
MATZUK SPERMATOZOA | 114 | 77 | All SZGR 2.0 genes in this pathway |
RUIZ TNC TARGETS UP | 153 | 107 | All SZGR 2.0 genes in this pathway |
SHEDDEN肺癌好生存A4 | 196 | 124 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 1HR UP | 61 | 44 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
GABRIELY MIR21 TARGETS | 289 | 187 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS UP | 221 | 120 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 3308 | 3314 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU | ||||
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-124/506 | 1458 | 1464 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-129-5p | 2241 | 2247 | m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-135 | 3524 | 3530 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA | ||||
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-142-5p | 2447 | 2453 | 1A | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-148/152 | 4195 | 4202 | 1A,m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-153 | 2238 | 2244 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-183 | 3714 | 3720 | 1A | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-186 | 2256 | 2262 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-214 | 3615 | 3621 | m8 | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
miR-29 | 2635 | 2641 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-324-3p | 2589 | 2595 | m8 | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
miR-448 | 2237 | 2244 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
miR-450 | 2241 | 2247 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.