Gene Page:OSM

Summary?
GeneID 5008
Symbol OSM
Synonyms -
Description oncostatin M
Reference MIM:165095|HGNC:HGNC:8506|Ensembl:ENSG00000099985|HPRD:01300|Vega:OTTHUMG00000150913
Gene type protein-coding
Map location 22q12.2
Pascal p-value 0.017
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.031
Literature High-throughput literature-search Co-occurance与精神分裂症nia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs8053315 chr16 83621092 OSM 5008 0.15 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005147 oncostatin-M receptor binding TAS 9920829
GO:0005125 cytokine activity TAS 2779549
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0001558 regulation of cell growth IEA -
GO:0008285 negative regulation of cell proliferation TAS 1717982
GO:0009408 response to heat IEA -
GO:0007422 peripheral nervous system development IEA -
GO:0006955 immune response IEA -
GO:0006915 apoptosis IEA -
GO:0007275 multicellular organismal development TAS 1717982
GO:0033138 positive regulation of peptidyl-serine phosphorylation IDA 7508917
GO:0042508 tyrosine phosphorylation of Stat1 protein IEA -
GO:0042506 tyrosine phosphorylation of Stat5 protein IEA -
GO:0042503 tyrosine phosphorylation of Stat3 protein IEA -
GO:0048266 behavioral response to pain IEA -
GO:0043410 positive regulation of MAPKKK cascade IDA 7508917
GO:0045944 positive regulation of transcription from RNA polymerase II promoter IDA 7508917
GO:0046888 negative regulation of hormone secretion IDA 7867561
GO:0050731 positive regulation of peptidyl-tyrosine phosphorylation IDA 7508917
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005615 extracellular space TAS 2779549

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG CYTOKINE CYTOKINE RECEPTOR INTERACTION 267 161 All SZGR 2.0 genes in this pathway
KEGG JAK STAT SIGNALING PATHWAY 155 105 All SZGR 2.0 genes in this pathway
PID GMCSF PATHWAY 37 31 All SZGR 2.0 genes in this pathway
PID IL3 PATHWAY 27 19 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP 485 293 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D DN 31 19 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP 431 237 All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE AUGMENTED BY MYC 108 74 All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING UP 108 69 All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP 390 236 All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING UP 115 80 All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN 138 92 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3 137 85 All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER UP 307 182 All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS UP 217 131 All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS 344 197 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-363 740 746 1A hsa-miR-363 AUUGCACGGUAUCCAUCUGUAA
miR-543 1006 1012 1A hsa-miR-543 AAACAUUCGCGGUGCACUUCU