Gene Page:SERPINB2

Summary?
GeneID 5055
Symbol SERPINB2
Synonyms HsT1201|PAI|PAI-2|PAI2|PLANH2
Description serpin peptidase inhibitor, clade B (ovalbumin), member 2
Reference MIM:173390|HGNC:HGNC:8584|Ensembl:ENSG00000197632|HPRD:01420|Vega:OTTHUMG00000060592
Gene type protein-coding
Map location 18q21.3
Pascal p-value 0.644
Fetal beta -1.063
DMG 1 (# studies)

Gene in Data Sources
基因集名称 Method of gene set Description Info
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg07871472 18 61567853 SERPINB2 5.483E-4 0.365 0.049 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
XPR1 0.93 0.97
CAPRIN1 0.93 0.97
CEP170 0.93 0.97
KDM5B 0.93 0.97
PPP2R3A 0.93 0.92
SPAST 0.92 0.96
SEMA3A 0.92 0.95
KIDINS220 0.92 0.96
STT3B 0.92 0.95
PRRC1 0.92 0.94
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SERPINB6 -0.65 -0.77
C5orf53 -0.65 -0.79
AIFM3 -0.65 -0.82
HLA-F -0.64 -0.81
TNFSF12 -0.64 -0.67
HEPN1 -0.64 -0.80
TSC22D4 -0.64 -0.85
PTH1R -0.63 -0.77
HSD17B14 -0.63 -0.82
LHPP -0.63 -0.63

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004252 serine-type endopeptidase activity IEA glutamate (GO term level: 7) -
GO:0004867 serine-type endopeptidase inhibitor activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006916 anti-apoptosis TAS 7499264
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BIOCARTA FIBRINOLYSIS PATHWAY 12 8 All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS 466 331 All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP 579 346 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP 485 293 All SZGR 2.0 genes in this pathway
CORRE MULTIPLE MYELOMA UP 74 45 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN 455 304 All SZGR 2.0 genes in this pathway
斯米尔诺夫循环内皮细胞癌症 158 103 All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP 233 161 All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP 185 126 All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP 457 269 All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP 238 144 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP 544 308 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP 431 237 All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN 226 132 All SZGR 2.0 genes in this pathway
GRAHAM CML QUIESCENT VS NORMAL QUIESCENT UP 87 45 All SZGR 2.0 genes in this pathway
GRAHAM CML QUIESCENT VS NORMAL DIVIDING UP 57 33 All SZGR 2.0 genes in this pathway
GRAHAM CML DIVIDING VS NORMAL QUIESCENT UP 181 101 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS F DN 33 24 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD DN 84 63 All SZGR 2.0 genes in this pathway
APPIERTO RESPONSE TO FENRETINIDE DN 51 35 All SZGR 2.0 genes in this pathway
DACOSTA ERCC3 ALLELE XPCS VS TTD DN 36 27 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
FALVELLA SMOKERS WITH LUNG CANCER 80 52 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769 437 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037 673 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC DN 31 23 All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC 24HR 5 DN 59 35 All SZGR 2.0 genes in this pathway
FRIDMAN SENESCENCE UP 77 60 All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 120 MCF10A 43 28 All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 240 MCF10A 57 36 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN 464 276 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 DN 169 102 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 3 DN 59 32 All SZGR 2.0 genes in this pathway
BYSTROEM CORRELATED WITH IL5 UP 51 30 All SZGR 2.0 genes in this pathway
MA MYELOID DIFFERENTIATION DN 44 30 All SZGR 2.0 genes in this pathway
LEI MYB TARGETS 318 215 All SZGR 2.0 genes in this pathway
GERY CEBP TARGETS 126 90 All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP 183 111 All SZGR 2.0 genes in this pathway
KANG IMMORTALIZED BY TERT UP 89 61 All SZGR 2.0 genes in this pathway
HANSON HRAS SIGNALING VIA NFKB 22 14 All SZGR 2.0 genes in this pathway
LIANG SILENCED BY METHYLATION 2 53 34 All SZGR 2.0 genes in this pathway
LY AGING PREMATURE DN 30 17 All SZGR 2.0 genes in this pathway
ABE VEGFA TARGETS 2HR 34 21 All SZGR 2.0 genes in this pathway
CHANG IMMORTALIZED BY HPV31 DN 65 45 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR DN 101 70 All SZGR 2.0 genes in this pathway
NIELSEN LIPOSARCOMA UP 18 13 All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES DN 245 144 All SZGR 2.0 genes in this pathway
MCCLUNG COCAIN REWARD 4WK 75 47 All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C1 72 45 All SZGR 2.0 genes in this pathway
LY老化中间了 14 11 All SZGR 2.0 genes in this pathway
LY AGING OLD DN 56 35 All SZGR 2.0 genes in this pathway
MAHAJAN RESPONSE TO IL1A UP 81 52 All SZGR 2.0 genes in this pathway
JOSEPH RESPONSE TO SODIUM BUTYRATE UP 31 21 All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES UP 253 147 All SZGR 2.0 genes in this pathway
SU PLACENTA 30 18 All SZGR 2.0 genes in this pathway
BILD HRAS ONCOGENIC SIGNATURE 261 166 All SZGR 2.0 genes in this pathway
BILD SRC ONCOGENIC SIGNATURE 62 38 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY 4NQO OR UV 63 44 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE DN 195 135 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
SARRIO EPITHELIAL MESENCHYMAL TRANSITION UP 180 114 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 UP 295 149 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN 315 197 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP 648 398 All SZGR 2.0 genes in this pathway
WINTER HYPOXIA METAGENE 242 168 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE DN 264 159 All SZGR 2.0 genes in this pathway
PARK APL PATHOGENESIS DN 50 35 All SZGR 2.0 genes in this pathway
RUIZ TNC TARGETS DN 142 79 All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS KERATINOCYTE UP 91 63 All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS FIBROBLAST UP 84 60 All SZGR 2.0 genes in this pathway
MCMURRAY TP53 HRAS COOPERATION RESPONSE UP 26 19 All SZGR 2.0 genes in this pathway
TAVAZOIE METASTASIS 108 68 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SURVIVAL UP 73 49 All SZGR 2.0 genes in this pathway
DASU IL6 SIGNALING UP 59 44 All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP 387 225 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549 316 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION TOP20 UP 20 14 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP 271 165 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS DN 148 88 All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP 364 236 All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 PARTIAL 160 106 All SZGR 2.0 genes in this pathway
BOSCO EPITHELIAL DIFFERENTIATION MODULE 69 31 All SZGR 2.0 genes in this pathway
GHANDHI DIRECT IRRADIATION UP 110 68 All SZGR 2.0 genes in this pathway
GHANDHI BYSTANDER IRRADIATION UP 86 54 All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF 516 308 All SZGR 2.0 genes in this pathway
NABA ECM REGULATORS 238 125 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR开始 UTR end Match method
miR-182 70 77 1A,m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-96 71 77 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC