Gene Page:PAK1
Summary?
| GeneID | 5058 |
| Symbol | PAK1 |
| Synonyms | PAKalpha |
| Description | p21 protein (Cdc42/Rac)-activated kinase 1 |
| Reference | MIM:602590|HGNC:HGNC:8590|Ensembl:ENSG00000149269|HPRD:03995|Vega:OTTHUMG00000165138 |
| Gene type | protein-coding |
| Map location | 11q13.5-q14.1 |
| Pascal p-value | 0.977 |
| Fetal beta | -1.603 |
| eGene | Myers' cis & trans |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.6755 |
Section I. Genetics and epigenetics annotation
eQTL annotation
eQTL annotation| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs6902183 | chr6 | 121963786 | PAK1 | 5058 | 0.17 | trans | ||
| rs7132043 | chr12 | 80968399 | PAK1 | 5058 | 0.12 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
酒吧和上显示代表低25%25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RARB | 0.93 | 0.48 |
| EBF1 | 0.93 | 0.41 |
| IKZF1 | 0.92 | 0.52 |
| ZNF521 | 0.91 | 0.61 |
| C10orf41 | 0.91 | 0.33 |
| DLX6 | 0.90 | 0.54 |
| PDYN | 0.89 | 0.35 |
| TSPAN9 | 0.88 | 0.56 |
| GPR149 | 0.88 | 0.53 |
| NTN1 | 0.88 | 0.44 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| CHPT1 | -0.24 | -0.25 |
| PTH1R | -0.23 | -0.35 |
| C5orf53 | -0.22 | -0.33 |
| AF347015.31 | -0.22 | -0.49 |
| COPZ2 | -0.22 | -0.41 |
| RTN4RL2 | -0.22 | 0.06 |
| COX4I2 | -0.22 | -0.45 |
| C1S | -0.22 | -0.02 |
| MUSTN1 | -0.22 | -0.38 |
| CA4 | -0.22 | -0.33 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005515 | protein binding | 新闻学会 | 12624090|12879077|15350535 |16278681|18086875 |
|
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004674 | protein serine/threonine kinase activity | TAS | 16278681 | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007528 | neuromuscular junction development | IEA | Synap (GO term level: 10) | - |
| GO:0016358 | dendrite development | IEA | neurite, dendrite (GO term level: 11) | - |
| GO:0000165 | MAPKKK cascade | IDA | 8805275 | |
| GO:0007010 | cytoskeleton organization | TAS | 16278681 | |
| GO:0006984 | ER-nuclear signaling pathway | TAS | 16278681 | |
| GO:0006915 | apoptosis | IEA | - | |
| GO:0043507 | positive regulation of JNK activity | IMP | 8805275 | |
| GO:0043113 | receptor clustering | IEA | - | |
| GO:0046777 | protein amino acid autophosphorylation | IDA | 8805275 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0030426 | growth cone | IEA | axon, dendrite (GO term level: 5) | - |
| GO:0030424 | axon | IEA | neuron, axon, Neurotransmitter (GO term level: 6) | - |
| GO:0005794 | Golgi apparatus | IDA | 18029348 | |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005737 | cytoplasm | IDA | 16278681 | |
| GO:0005886 | plasma membrane | IDA | 16278681 | |
| GO:0030054 | cell junction | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ABI3 | NESH | SSH3BP3 | ABI family, member 3 | - | HPRD,BioGRID | 11956071 |
| AKT1 | AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHA | v-akt murine thymoma viral oncogene homolog 1 | Reconstituted Complex | BioGRID | 14749719 |
| ARHGDIA | GDIA1 | MGC117248 | RHOGDI | RHOGDI-1 | Rho GDP dissociation inhibitor (GDI) alpha | Pak1 interacts with and phosphorylates RhoGDI. This interaction was modeled on a demonstrated interaction between Pak1 from an unspecified species and human RhoGDI. | BIND | 15225553 |
| ARHGEF2 | DKFZp547L106 | DKFZp547P1516 | GEF | GEF-H1 | GEFH1 | KIAA0651 | LFP40 | P40 | rho/rac guanine nucleotide exchange factor (GEF) 2 | Affinity Capture-MS Reconstituted Complex |
BioGRID | 14970201 |
| ARHGEF6 | COOL2 | Cool-2 | KIAA0006 | MRX46 | PIXA | alpha-PIX | alphaPIX | Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 | - | HPRD,BioGRID | 9659915 |
| ARHGEF7 | BETA-PIX | COOL1 | DKFZp686C12170 | DKFZp761K1021 | KIAA0142 | KIAA0412 | Nbla10314 | P50 | P50BP | P85 | P85COOL1 | P85SPR | PAK3 | PIXB | Rho guanine nucleotide exchange factor (GEF) 7 | - | HPRD,BioGRID | 11157752|12006652 |
| ARPC1B | ARC41 | p40-ARC | p41-ARC | actin related protein 2/3 complex, subunit 1B, 41kDa | - | HPRD,BioGRID | 14749719 |
| BAIAP2 | BAP2 | IRSP53 | BAI1-associated protein 2 | Reconstituted Complex | BioGRID | 11130076 |
| BMX | ETK | PSCTK2 | PSCTK3 | BMX non-receptor tyrosine kinase | - | HPRD,BioGRID | 11382770 |
| CDC2L2 | CDC2L3 | CDK11-p110 | CDK11-p46 | CDK11-p58 | MGC131975 | PITSLRE | p58GTA | cell division cycle 2-like 2 (PITSLRE proteins) | - | HPRD,BioGRID | 12624090 |
| CDC42 | CDC42Hs | G25K | cell division cycle 42 (GTP binding protein, 25kDa) | Reconstituted Complex | BioGRID | 12650940 |
| CDC42 | CDC42Hs | G25K | cell division cycle 42 (GTP binding protein, 25kDa) | PAK1 interacts with an unspecified isoform of Cdc42. This interaction was modeled on a demonstrated interaction between PAK1 from an unspecified species and human Cdc42. | BIND | 15864311 |
| CDC42 | CDC42Hs | G25K | cell division cycle 42 (GTP binding protein, 25kDa) | - | HPRD | 7744004|8107774 |9705280|9705280 |
| CDC42 | CDC42Hs | G25K | cell division cycle 42 (GTP binding protein, 25kDa) | Cdc42 interacts with Pak1. This interaction was modelled on a demonstrated interaction between Cdc42 from an unspecified species and human Pak1. | BIND | 12944407 |
| CDK5 | PSSALRE | cyclin-dependent kinase 5 | Affinity Capture-Western Biochemical Activity |
BioGRID | 11604394 |
| CDK5R1 | CDK5P35 | CDK5R | MGC33831 | NCK5A | p23 | p25 | p35 | p35nck5a | cyclin-dependent kinase 5, regulatory subunit 1 (p35) | - | HPRD | 11604394 |
| COL1A1 | OI4 | collagen, type I, alpha 1 | - | HPRD,BioGRID | 10772928 |
| CSNK2A1 | CK2A1 | CKII | casein kinase 2, alpha 1 polypeptide | - | HPRD | 10938077 |
| CSNK2A2 | CK2A2 | CSNK2A1 | FLJ43934 | casein kinase 2, alpha prime polypeptide | - | HPRD | 10938077 |
| DYNLL1 | DLC1 | DLC8 | DNCL1 | DNCLC1 | LC8 | LC8a | MGC126137 | MGC126138 | PIN | hdlc1 | dynein, light chain, LC8-type 1 | Affinity Capture-Western Biochemical Activity Reconstituted Complex Two-hybrid |
BioGRID | 15193260 |
| EGFR | ERBB | ERBB1 | HER1 | PIG61 | mENA | epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) | Tyrosine-phosphorylated EGFR interacts with PAK1. | BIND | 12522133 |
| ERBB2 | CD340 | HER-2 | HER-2/neu | HER2 | NEU | NGL | TKR1 | v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) | - | HPRD,BioGRID | 9774445 |
| GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | PAK1 interacts with Grb2. | BIND | 12522133 |
| HGS | HRS | ZFYVE8 | hepatocyte growth factor-regulated tyrosine kinase substrate | - | HPRD,BioGRID | 11397816 |
| HIST4H4 | H4/p | MGC24116 | histone cluster 4, H4 | PAK1 phosphorylates H4. This interaction was modeled on a demonstrated interaction between human PAK1 and H4 from an unspecified species. | BIND | 15864311 |
| LIMK1 | LIMK | LIM domain kinase 1 | - | HPRD,BioGRID | 10559936 |
| MYLK | DKFZp686I10125 | FLJ12216 | KRP | MLCK | MLCK1 | MLCK108 | MLCK210 | MSTP083 | MYLK1 | smMLCK | myosin light chain kinase | - | HPRD,BioGRID | 10092231 |
| NCF1C | SH3PXD1C | neutrophil cytosolic factor 1C pseudogene | Pak1 interacts with and phosphorylates P47. This interaction was modeled on a demonstrated interaction between Pak1 and P47 from unspecified species. | BIND | 15225553 |
| NCK1 | MGC12668 | NCK | NCKalpha | NCK adaptor protein 1 | - | HPRD | 8824201|11278241 |
| NCK1 | MGC12668 | NCK | NCKalpha | NCK adaptor protein 1 | Nck interacts with PAK1 | BIND | 8824201 |
| NCK1 | MGC12668 | NCK | NCKalpha | NCK adaptor protein 1 | - | HPRD,BioGRID | 8824201 |
| NCK2 | GRB4 | NCKbeta | NCK adaptor protein 2 | - | HPRD,BioGRID | 10026169|11557983 |
| NF2 | ACN | BANF | SCH | neurofibromin 2 (merlin) | 梅林与Pak1 | BIND | 14580336 |
| NF2 | ACN | BANF | SCH | neurofibromin 2 (merlin) | - | HPRD | 14580336 |
| PAK1 | MGC130000 | MGC130001 | PAKalpha | p21 protein (Cdc42/Rac)-activated kinase 1 | - | HPRD,BioGRID | 11804587 |
| PAK1IP1 | FLJ20624 | MAK11 | PIP1 | RP11-421M1.5 | WDR84 | bA421M1.5 | hPIP1 | PAK1 interacting protein 1 | - | HPRD,BioGRID | 11371639 |
| PKLR | PK1 | PKL | PKR | PKRL | RPK | pyruvate kinase, liver and RBC | Affinity Capture-Western | BioGRID | 12006652 |
| PLCG1 | PLC-II | PLC1 | PLC148 | PLCgamma1 | phospholipase C, gamma 1 | - | HPRD,BioGRID | 12085993 |
| PPM1F | CaMKPase | FEM-2 | KIAA0015 | POPX2 | hFEM-2 | protein phosphatase 1F (PP2C domain containing) | - | HPRD | 11864573 |
| PXN | FLJ16691 | paxillin | - | HPRD | 10330411 |
| RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | PAK1 interacts with an unspecified isoform of Rac. This interaction was modeled on a demonstrated interaction between human PAK1 and Rac from Chinese hamster. | BIND | 15975516 |
| RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | PAK1 interacts with an unspecified isoform of Rac. This interaction was modeled on a demonstrated interaction between PAK1 from an unspecified species and human Rac. | BIND | 15864311 |
| RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | - | HPRD | 7744004|8107774 |11134022|11950930|11134022 |
| RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | Reconstituted Complex | BioGRID | 12650940|12879077 |
| RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | Active GTP-bound RAC1 interacts with PAK1B. This interaction was modelled on a demonstrated interaction between chicken RAC1 and human PAK1B. | BIND | 15735674 |
| RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | Rac1 interacts with Pak1. This interaction was modeled on a demonstrated interaction between Rac1 and Pak1 from an unspecified species. | BIND | 15652748 |
| RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | Rac1 interacts with Pak1. This interaction was modelled on a demonstrated interacton between Rac1 from an unspecified species and human Pak1. | BIND | 12944407 |
| RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | - | HPRD,BioGRID | 11733498 |
| RHOJ | ARHJ | FLJ14445 | MGC34777 | RASL7B | TC10B | TCL | ras homolog gene family, member J | - | HPRD,BioGRID | 10967094 |
| RHOU | ARHU | CDC42L1 | DJ646B12.2 | FLJ10616 | WRCH1 | fJ646B12.2 | hG28K | ras homolog gene family, member U | Wrch-1 interacts with PAK. This interaction was modeled on a demonstrated interactions between human Wrch-1 and rat PAK. | BIND | 15556869 |
| SPEN | KIAA0929 | MINT | RP1-134O19.1 | SHARP | spen homolog, transcriptional regulator (Drosophila) | Pak1 phosphorylates SHARP. This interaction was modeled on a demonstrated interaction between Pak1 and SHARP both from an unspecified species. | BIND | 15824732 |
| TGFBR2 | AAT3 | FAA3 | LDS1B | LDS2B | MFS2 | RIIC | TAAD2 | TGFR-2 | TGFbeta-RII | transforming growth factor, beta receptor II (70/80kDa) | T-beta-RII interacts with PAK1. This interaction was modeled on a demonstrated interaction between human T-beta-RII and mouse PAK1. | BIND | 15761153 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
| KEGG ERBB SIGNALING PATHWAY | 87 | 71 | All SZGR 2.0 genes in this pathway |
| KEGG CHEMOKINE SIGNALING PATHWAY | 190 | 128 | All SZGR 2.0 genes in this pathway |
| KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
| KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
| KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY | 137 | 92 | All SZGR 2.0 genes in this pathway |
| KEGG T CELL RECEPTOR SIGNALING PATHWAY | 108 | 89 | All SZGR 2.0 genes in this pathway |
| KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS | 97 | 71 | All SZGR 2.0 genes in this pathway |
| KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
| KEGG EPITHELIAL CELL SIGNALING IN HELICOBACTER PYLORI INFECTION | 68 | 44 | All SZGR 2.0 genes in this pathway |
| KEGG RENAL CELL CARCINOMA | 70 | 60 | All SZGR 2.0 genes in this pathway |
| BIOCARTA AGR PATHWAY | 36 | 31 | All SZGR 2.0 genes in this pathway |
| BIOCARTA AT1R PATHWAY | 36 | 28 | All SZGR 2.0 genes in this pathway |
| BIOCARTA FAS PATHWAY | 30 | 22 | All SZGR 2.0 genes in this pathway |
| BIOCARTA FMLP PATHWAY | 39 | 29 | All SZGR 2.0 genes in this pathway |
| BIOCARTA RACCYCD PATHWAY | 26 | 23 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PYK2 PATHWAY | 31 | 24 | All SZGR 2.0 genes in this pathway |
| BIOCARTA MAPK PATHWAY | 87 | 68 | All SZGR 2.0 genes in this pathway |
| BIOCARTA RAC1 PATHWAY | 23 | 16 | All SZGR 2.0 genes in this pathway |
| BIOCARTA NKCELLS PATHWAY | 20 | 13 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CDC42RAC PATHWAY | 16 | 13 | All SZGR 2.0 genes in this pathway |
| BIOCARTA MET PATHWAY | 37 | 30 | All SZGR 2.0 genes in this pathway |
| BIOCARTA TNFR1 PATHWAY | 29 | 21 | All SZGR 2.0 genes in this pathway |
| SIG PIP3 SIGNALING IN CARDIAC MYOCTES | 67 | 54 | All SZGR 2.0 genes in this pathway |
| SIG CHEMOTAXIS | 45 | 37 | All SZGR 2.0 genes in this pathway |
| SIG REGULATION OF THE ACTIN CYTOSKELETON BY RHO GTPASES | 35 | 25 | All SZGR 2.0 genes in this pathway |
| ST INTEGRIN SIGNALING PATHWAY | 82 | 62 | All SZGR 2.0 genes in this pathway |
| ST T CELL SIGNAL TRANSDUCTION | 45 | 33 | All SZGR 2.0 genes in this pathway |
| PID MET PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
| PID EPHB FWD PATHWAY | 40 | 38 | All SZGR 2.0 genes in this pathway |
| PID P38 ALPHA BETA PATHWAY | 31 | 25 | All SZGR 2.0 genes in this pathway |
| PID CDC42 PATHWAY | 70 | 51 | All SZGR 2.0 genes in this pathway |
| PID ANGIOPOIETIN RECEPTOR PATHWAY | 50 | 41 | All SZGR 2.0 genes in this pathway |
| PID NETRIN PATHWAY | 32 | 27 | All SZGR 2.0 genes in this pathway |
| PID CXCR4 PATHWAY | 102 | 78 | All SZGR 2.0 genes in this pathway |
| 近端PID ERBB1受体途径 | 35 | 29 | All SZGR 2.0 genes in this pathway |
| PID PLK1 PATHWAY | 46 | 25 | All SZGR 2.0 genes in this pathway |
| PID PDGFRB PATHWAY | 129 | 103 | All SZGR 2.0 genes in this pathway |
| PID AURORA A PATHWAY | 31 | 20 | All SZGR 2.0 genes in this pathway |
| PID S1P S1P2 PATHWAY | 24 | 19 | All SZGR 2.0 genes in this pathway |
| PID EPHA2 FWD PATHWAY | 19 | 16 | All SZGR 2.0 genes in this pathway |
| PID RAC1 PATHWAY | 54 | 37 | All SZGR 2.0 genes in this pathway |
| PID FAK PATHWAY | 59 | 45 | All SZGR 2.0 genes in this pathway |
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL CELL COMMUNICATION | 120 | 77 | All SZGR 2.0 genes in this pathway |
| REACTOME TCR SIGNALING | 54 | 46 | All SZGR 2.0 genes in this pathway |
| REACTOME GENERATION OF SECOND MESSENGER MOLECULES | 27 | 25 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME CD28 CO STIMULATION | 32 | 26 | All SZGR 2.0 genes in this pathway |
| REACTOME ACTIVATION OF RAC | 14 | 11 | All SZGR 2.0 genes in this pathway |
| REACTOME SEMA3A PAK DEPENDENT AXON REPULSION | 15 | 14 | All SZGR 2.0 genes in this pathway |
| REACTOME CD28 DEPENDENT VAV1 PATHWAY | 11 | 10 | All SZGR 2.0 genes in this pathway |
| REACTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
| REACTOME COSTIMULATION BY THE CD28 FAMILY | 63 | 48 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY ROBO RECEPTOR | 30 | 26 | All SZGR 2.0 genes in this pathway |
| REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNAL TRANSDUCTION BY L1 | 34 | 25 | All SZGR 2.0 genes in this pathway |
| REACTOME DSCAM INTERACTIONS | 11 | 10 | All SZGR 2.0 genes in this pathway |
| REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
| REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
| HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| CHIN BREAST CANCER COPY NUMBER UP | 27 | 18 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| SNIJDERS AMPLIFIED IN HEAD AND NECK TUMORS | 37 | 27 | All SZGR 2.0 genes in this pathway |
| PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
| OXFORD RALA OR RALB TARGETS DN | 24 | 17 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
| BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 11Q12 Q14 AMPLICON | 158 | 93 | All SZGR 2.0 genes in this pathway |
| MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA HP UP | 49 | 26 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| VERRECCHIA RESPONSE TO TGFB1 C1 | 19 | 15 | All SZGR 2.0 genes in this pathway |
| VERRECCHIA EARLY RESPONSE TO TGFB1 | 58 | 43 | All SZGR 2.0 genes in this pathway |
| WU HBX TARGETS 3 DN | 13 | 9 | All SZGR 2.0 genes in this pathway |
| LEE CALORIE RESTRICTION NEOCORTEX DN | 88 | 58 | All SZGR 2.0 genes in this pathway |
| BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
| DURCHDEWALD SKIN CARCINOGENESIS DN | 264 | 168 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
| MCCABE HOXC6 TARGETS DN | 21 | 15 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
| CLIMENT BREAST CANCER COPY NUMBER UP | 23 | 20 | All SZGR 2.0 genes in this pathway |
| MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
| WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
| RAY TARGETS OF P210 BCR ABL FUSION DN | 16 | 11 | All SZGR 2.0 genes in this pathway |
| 华莱士JAK2 TARGETS UP | 26 | 15 | All SZGR 2.0 genes in this pathway |
| LEE RECENT THYMIC EMIGRANT | 227 | 128 | All SZGR 2.0 genes in this pathway |
| ONO AML1 TARGETS UP | 24 | 14 | All SZGR 2.0 genes in this pathway |
| ONO FOXP3 TARGETS UP | 23 | 15 | All SZGR 2.0 genes in this pathway |
| HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
| CHANDRAN METASTASIS DN | 306 | 191 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 1HR DN | 222 | 147 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
| TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| KATSANOU ELAVL1 TARGETS DN | 148 | 88 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
| CHEMELLO SOLEUS VS EDL MYOFIBERS DN | 19 | 10 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| let-7/98 | 1089 | 1095 | m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
| hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
| hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
| hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
| hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
| hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
| hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
| hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
| hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
| miR-150 | 554 | 560 | 1A | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
| miR-221/222 | 659 | 666 | 1A,m8 | hsa-miR-221brain | AGCUACAUUGUCUGCUGGGUUUC |
| hsa-miR-222brain | AGCUACAUCUGGCUACUGGGUCUC | ||||
| miR-34b | 1202 | 1208 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
| miR-376c | 657 | 663 | 1A | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
| miR-485-5p | 15 | 22 | 1A,m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
| miR-96 | 25 | 31 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.