Gene Page:PAK2
Summary?
GeneID | 5062 |
Symbol | PAK2 |
Synonyms | PAK65|PAKgamma |
Description | p21 protein (Cdc42/Rac)-activated kinase 2 |
Reference | MIM:605022|HGNC:HGNC:8591|Ensembl:ENSG00000180370|HPRD:05428|Vega:OTTHUMG00000155534 |
Gene type | protein-coding |
Map location | 3q29 |
Pascal p-value | 0.019 |
Sherlock p-value | 0.099 |
Fetal beta | 1.644 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CNV:YES | Copy number variation studies | Manual curation | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | 与精神分裂症Co-occurance关键词:schizophrenia,schizophrenic,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0435 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg02319016 | 3 | 196469777 | PAK2 | 5.425E-4 | 0.377 | 0.048 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1983892 | chr6 | 41537567 | PAK2 | 5062 | 0.01 | trans | ||
rs1502683 | chr9 | 85599579 | PAK2 | 5062 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PAK2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NONO | 0.96 | 0.94 |
APEX1 | 0.96 | 0.94 |
KDM1 | 0.95 | 0.94 |
HNRNPL | 0.95 | 0.94 |
RBMX | 0.95 | 0.95 |
RBBP4 | 0.95 | 0.94 |
FUBP1 | 0.94 | 0.92 |
SMAD4 | 0.94 | 0.90 |
SF3B3 | 0.94 | 0.92 |
TH1L | 0.94 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.71 | -0.88 |
AF347015.27 | -0.71 | -0.88 |
MT-CO2 | -0.70 | -0.88 |
C5orf53 | -0.69 | -0.76 |
AF347015.33 | -0.69 | -0.86 |
MT-CYB | -0.68 | -0.87 |
HLA-F | -0.68 | -0.76 |
AIFM3 | -0.68 | -0.77 |
AF347015.8 | -0.68 | -0.88 |
IFI27 | -0.66 | -0.83 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004674 | protein serine/threonine kinase activity | IDA | 11805089 | |
GO:0016740 | transferase activity | IEA | - | |
GO:0042802 | identical protein binding | 新闻学会 | 16837009 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001558 | regulation of cell growth | IEA | - | |
GO:0006469 | negative regulation of protein kinase activity | TAS | 10748018 | |
GO:0007165 | signal transduction | TAS | 7744004 | |
GO:0006915 | apoptosis | IEA | - | |
GO:0044419 | interspecies interaction between organisms | IEA | - | |
GO:0046777 | protein amino acid autophosphorylation | IDA | 11805089 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | EXP | 15234964 | |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0016020 | membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ABI1 | ABI-1 | E3B1 | NAP1BP | SSH3BP | SSH3BP1 | abl-interactor 1 | - | HPRD | 11956071 |
ABI3 | NESH | SSH3BP3 | ABI family, member 3 | - | HPRD,BioGRID | 11956071 |
ABL1 | ABL | JTK7 | bcr/abl | c-ABL | p150 | v-abl | c-abl oncogene 1, receptor tyrosine kinase | - | HPRD,BioGRID | 11121037 |
ARHGEF7 | BETA-PIX | COOL1 | DKFZp686C12170 | DKFZp761K1021 | KIAA0142 | KIAA0412 | Nbla10314 | P50 | P50BP | P85 | P85COOL1 | P85SPR | PAK3 | PIXB | ρ鸟嘌呤核苷酸交换因子(GEF) 7 | - | HPRD,BioGRID | 12226077 |
CDC42 | CDC42Hs | G25K | cell division cycle 42 (GTP binding protein, 25kDa) | - | HPRD,BioGRID | 10320322 |
DOCK2 | FLJ46592 | KIAA0209 | dedicator of cytokinesis 2 | Reconstituted Complex | BioGRID | 12176041 |
GIT1 | - | G protein-coupled receptor kinase interacting ArfGAP 1 | Affinity Capture-MS | BioGRID | 17353931 |
GIT2 | CAT-2 | DKFZp686G01261 | KIAA0148 | MGC760 | G protein-coupled receptor kinase interacting ArfGAP 2 | Affinity Capture-MS | BioGRID | 17353931 |
MCM3 | HCC5 | MGC1157 | P1-MCM3 | P1.h | RLFB | minichromosome maintenance complex component 3 | Affinity Capture-MS | BioGRID | 17353931 |
MYH10 | MGC134913 | MGC134914 | NMMHCB | myosin, heavy chain 10, non-muscle | Affinity Capture-MS | BioGRID | 17353931 |
MYL2 | CMH10 | DKFZp779C0562 | MLC2 | myosin, light chain 2, regulatory, cardiac, slow | - | HPRD,BioGRID | 10047984 |
NCK1 | MGC12668 | NCK | NCKalpha | NCK adaptor protein 1 | - | HPRD | 11160719 |
PAK2 | PAK65 | PAKgamma | p21 protein (Cdc42/Rac)-activated kinase 2 | hPAK65 autophosphorylates. | BIND | 9151826 |
RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | - | HPRD,BioGRID | 9535855 |
RAC2 | EN-7 | Gx | HSPC022 | ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) | Reconstituted Complex | BioGRID | 12176041 |
SH3KBP1 | CIN85 | GIG10 | MIG18 | SH3-domain kinase binding protein 1 | - | HPRD,BioGRID | 12829691 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
KEGG ERBB SIGNALING PATHWAY | 87 | 71 | All SZGR 2.0 genes in this pathway |
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
KEGG T CELL RECEPTOR SIGNALING PATHWAY | 108 | 89 | All SZGR 2.0 genes in this pathway |
KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
KEGG RENAL CELL CARCINOMA | 70 | 60 | All SZGR 2.0 genes in this pathway |
BIOCARTA AGR PATHWAY | 36 | 31 | All SZGR 2.0 genes in this pathway |
BIOCARTA FAS PATHWAY | 30 | 22 | All SZGR 2.0 genes in this pathway |
BIOCARTA FCER1 PATHWAY | 41 | 30 | All SZGR 2.0 genes in this pathway |
BIOCARTA HIVNEF PATHWAY | 58 | 43 | All SZGR 2.0 genes in this pathway |
BIOCARTA MAPK PATHWAY | 87 | 68 | All SZGR 2.0 genes in this pathway |
BIOCARTA TNFR1 PATHWAY | 29 | 21 | All SZGR 2.0 genes in this pathway |
SIG PIP3 SIGNALING IN CARDIAC MYOCTES | 67 | 54 | All SZGR 2.0 genes in this pathway |
SIG CHEMOTAXIS | 45 | 37 | All SZGR 2.0 genes in this pathway |
SIG REGULATION OF THE ACTIN CYTOSKELETON BY RHO GTPASES | 35 | 25 | All SZGR 2.0 genes in this pathway |
ST INTEGRIN SIGNALING PATHWAY | 82 | 62 | All SZGR 2.0 genes in this pathway |
ST T CELL SIGNAL TRANSDUCTION | 45 | 33 | All SZGR 2.0 genes in this pathway |
PID FCER1 PATHWAY | 62 | 43 | All SZGR 2.0 genes in this pathway |
PID MET PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
PID P38 ALPHA BETA PATHWAY | 31 | 25 | All SZGR 2.0 genes in this pathway |
PID CDC42 PATHWAY | 70 | 51 | All SZGR 2.0 genes in this pathway |
PID MYC PATHWAY | 25 | 22 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
PID RAC1 PATHWAY | 54 | 37 | All SZGR 2.0 genes in this pathway |
意图CTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
意图CTOME TCR SIGNALING | 54 | 46 | All SZGR 2.0 genes in this pathway |
意图CTOME GENERATION OF SECOND MESSENGER MOLECULES | 27 | 25 | All SZGR 2.0 genes in this pathway |
意图CTOME REGULATION OF APOPTOSIS | 58 | 34 | All SZGR 2.0 genes in this pathway |
意图CTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
意图CTOME CD28 CO STIMULATION | 32 | 26 | All SZGR 2.0 genes in this pathway |
意图CTOME ACTIVATION OF RAC | 14 | 11 | All SZGR 2.0 genes in this pathway |
意图CTOME SEMA3A PAK DEPENDENT AXON REPULSION | 15 | 14 | All SZGR 2.0 genes in this pathway |
意图CTOME CD28 DEPENDENT VAV1 PATHWAY | 11 | 10 | All SZGR 2.0 genes in this pathway |
意图CTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
意图CTOME COSTIMULATION BY THE CD28 FAMILY | 63 | 48 | All SZGR 2.0 genes in this pathway |
意图CTOME SIGNALING BY ROBO RECEPTOR | 30 | 26 | All SZGR 2.0 genes in this pathway |
意图CTOME APOPTOSIS | 148 | 94 | All SZGR 2.0 genes in this pathway |
意图CTOME HIV INFECTION | 207 | 122 | All SZGR 2.0 genes in this pathway |
意图CTOME HOST INTERACTIONS OF HIV FACTORS | 132 | 81 | All SZGR 2.0 genes in this pathway |
意图CTOME THE ROLE OF NEF IN HIV1 REPLICATION AND DISEASE PATHOGENESIS | 28 | 19 | All SZGR 2.0 genes in this pathway |
意图CTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
意图CTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
意图CTOME APOPTOTIC EXECUTION PHASE | 54 | 37 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
ZERBINI RESPONSE TO SULINDAC UP | 9 | 6 | All SZGR 2.0 genes in this pathway |
BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS UP | 269 | 146 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN | 275 | 168 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS UP | 214 | 134 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
LAU APOPTOSIS CDKN2A UP | 55 | 40 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
BALDWIN PRKCI TARGETS UP | 35 | 26 | All SZGR 2.0 genes in this pathway |
DING LUNG CANCER EXPRESSION BY COPY NUMBER | 100 | 62 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
JI RESPONSE TO FSH DN | 58 | 43 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
VERRECCHIA DELAYED RESPONSE TO TGFB1 | 39 | 26 | All SZGR 2.0 genes in this pathway |
JAZAERI BREAST CANCER BRCA1 VS BRCA2 UP | 49 | 28 | All SZGR 2.0 genes in this pathway |
VERRECCHIA RESPONSE TO TGFB1 C4 | 13 | 10 | All SZGR 2.0 genes in this pathway |
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
MCCABE HOXC6 TARGETS CANCER DN | 20 | 12 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 2HR DN | 49 | 33 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-26 | 351 | 358 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-9 | 829 | 835 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.