Gene Page:HP1BP3
Summary?
| GeneID | 50809 |
| Symbol | HP1BP3 |
| Synonyms | HP1-BP74|HP1BP74 |
| Description | heterochromatin protein 1 binding protein 3 |
| Reference | MIM:616072|HGNC:HGNC:24973|Ensembl:ENSG00000127483|HPRD:11026|Vega:OTTHUMG00000002622 |
| Gene type | protein-coding |
| Map location | 1p36.12 |
| Pascal p-value | 0.008 |
| Fetal beta | 1.513 |
| DMG | 1 (# studies) |
| eGene | Cerebellum |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Differentially methylated gene| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg18436758 | 1 | 21113190 | HP1BP3 | 4.67E-5 | -0.247 | 0.021 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | 去你rm | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | IEA | - | |
| Biological process | 去你rm | Evidence | Neuro keywords | PubMed ID |
| GO:0006334 | nucleosome assembly | IEA | - | |
| Cellular component | 去你rm | Evidence | Neuro keywords | PubMed ID |
| GO:0000786 | nucleosome | IEA | - | |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005694 | chromosome | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PUIFFE INVASION INHIBITED BY ASCITES UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
| DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS UP | 293 | 179 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
| HEDENFALK BREAST CANCER BRCA1 VS BRCA2 | 163 | 113 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| RAY TUMORIGENESIS BY ERBB2 CDC25A DN | 159 | 105 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE G2 | 182 | 102 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE G2 M | 216 | 124 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
| VANDESLUIS NORMAL EMBRYOS DN | 25 | 13 | All SZGR 2.0 genes in this pathway |
| VANOEVELEN MYOGENESIS SIN3A TARGETS | 220 | 133 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-1/206 | 1898 | 1904 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
| miR-122 | 498 | 504 | 1A | hsa-miR-122a | UGGAGUGUGACAAUGGUGUUUGU |
| miR-208 | 1825 | 1831 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
| miR-433-3p | 21 | 27 | m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
| miR-493-5p | 2070 | 2076 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-499 | 1825 | 1831 | 1A | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
| miR-543 | 1534 | 1540 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.