Gene Page:STMN3

Summary?
GeneID 50861
Symbol STMN3
Synonyms SCLIP
Description stathmin 3
Reference MIM:608362|HGNC:HGNC:15926|Ensembl:ENSG00000197457|HPRD:16324|Vega:OTTHUMG00000032985
Gene type protein-coding
Map location 20q13.3
Pascal p-value 0.001
Sherlock p-value 0.905
Fetal beta -0.706
DMG 1 (# studies)
eGene Cerebellar Hemisphere
Cerebellum
Cortex

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccur High-throughput literature-search 系统的烤焦ch in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg04757428 20 62284615 STMN3 1.529E-4 -0.638 0.032 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0019904 protein domain specific binding ISS -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0031175 neurite development ISS neuron, axon, neurite, dendrite (GO term level: 10) -
GO:0007399 nervous system development TAS neurite (GO term level: 5) 9603203
GO:0007242 intracellular signaling cascade IEA -
GO:0035021 negative regulation of Rac protein signal transduction ISS -
GO:0032314 regulation of Rac GTPase activity ISS -
GO:0031122 cytoplasmic microtubule organization ISS -
GO:0051493 regulation of cytoskeleton organization ISS -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm ISS -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BASAKI YBX1 TARGETS DN 384 230 All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN 260 143 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536 332 All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA SIZE UP 23 12 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805 505 All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN 781 465 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B 392 251 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN 164 111 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION DN 517 309 All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 20Q12 Q13 AMPLICON 149 76 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP 100 72 All SZGR 2.0 genes in this pathway
BILD MYC ONCOGENIC SIGNATURE 206 117 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 528 324 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 307 185 All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED 728 415 All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS 245 148 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN 435 289 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721 492 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
STAMBOLSKY TARGETS OF MUTATED TP53 UP 49 35 All SZGR 2.0 genes in this pathway
STAMBOLSKY RESPONSE TO VITAMIN D3 UP 84 48 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT 572 352 All SZGR 2.0 genes in this pathway
国外RB1增长目标 243 155 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
KOHOUTEK CCNT1 TARGETS 50 26 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-151 72 78 1A hsa-miR-151brain ACUAGACUGAAGCUCCUUGAGG