Gene Page:INSIG2

Summary?
GeneID 51141
Symbol INSIG2
Synonyms -
Description insulin induced gene 2
Reference MIM:608660|HGNC:HGNC:20452|Ensembl:ENSG00000125629|HPRD:16361|Vega:OTTHUMG00000058518
Gene type protein-coding
Map location 2q14.2
Pascal p-value 0.067
Fetal beta -0.394

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.0004
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00755
Literature High-throughput literature-search 与精神分裂症Co-occurance keywords: schizophrenia,schizophrenic,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Biological process GO term Evidence Neuro keywords PubMed ID
GO:0008202 steroid metabolic process IEA -
GO:0008203 cholesterol metabolic process IEA -
GO:0006629 lipid metabolic process IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005789 endoplasmic reticulum membrane IEA -
GO:0005783 endoplasmic reticulum IEA -
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PRAMOONJAGO SOX4 TARGETS UP 52 38 All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA UP 171 112 All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG UP 130 85 All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A TARGETS DN 91 58 All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A AND HIF2A TARGETS DN 104 72 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA HIF1A DN 110 78 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A UP 142 104 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769 437 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037 673 All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648 385 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424 268 All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO ESTRADIOL DN 82 52 All SZGR 2.0 genes in this pathway
MENSE缺氧了 98 71 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR 544 307 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN 318 220 All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6 153 112 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS DN 314 188 All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN 220 147 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN 540 340 All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS 425 261 All SZGR 2.0 genes in this pathway
GRADE COLON VS RECTAL CANCER UP 38 21 All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS DN 210 128 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN 442 275 All SZGR 2.0 genes in this pathway
CHEN LIVER METABOLISM QTL CIS 93 40 All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP 176 110 All SZGR 2.0 genes in this pathway
ZEMBUTSU SENSITIVITY TO VINBLASTINE 18 12 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE S 162 86 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 DN 88 61 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 DN 82 51 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE 317 190 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP 682 433 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A 770 480 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 227 149 All SZGR 2.0 genes in this pathway
BOUDOUKHA BOUND BY IGF2BP2 111 59 All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 2HR DN 55 35 All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR DN 114 69 All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF 516 308 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-30-5p 1645 1651 m8 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrain UGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZ UGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZ UGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGA
miR-375 1568 1574 1A hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
miR-376 1636 1642 m8 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
miR-377 1451 1457 1A hsa-miR-377 AUCACACAAAGGCAACUUUUGU
miR-96 331 337 m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC