Gene Page:PLEKHO1
Summary?
GeneID | 51177 |
Symbol | PLEKHO1 |
Synonyms | CKIP-1|CKIP1|JBP|OC120 |
Description | pleckstrin homology domain containing O1 |
Reference | MIM:608335|HGNC:HGNC:24310|Ensembl:ENSG00000023902|HPRD:12217|Vega:OTTHUMG00000012510 |
Gene type | protein-coding |
Map location | 1q21.2 |
Sherlock p-value | 0.365 |
Fetal beta | 0.971 |
DMG | 4 (# studies) |
eGene | Cerebellum |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 6 |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 6 |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 6 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 6 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg01570589 | 1 | 150121725 | PLEKHO1 | 1.386E-4 | 0.575 | 0.031 | DMG:Wockner_2014 |
cg20785674 | 1 | 150123490 | PLEKHO1 | 2.178E-4 | 0.931 | 0.036 | DMG:Wockner_2014 |
cg00095674 | 1 | 150122654 | PLEKHO1 | -0.03 | 0.39 | DMG:Nishioka_2013 | |
cg18945035 | 1 | 150122690 | PLEKHO1 | 1.68E-8 | -0.009 | 6.13E-6 | DMG:Jaffe_2016 |
cg07807709 | 1 | 149860026 | PLEKHO1 | 0.002 | 4.209 | DMG:vanEijk_2014 | |
cg03086563 | 1 | 149857152 | PLEKHO1 | 0.002 | 2.498 | DMG:vanEijk_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PLEKHO1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0045786 | negative regulation of cell cycle | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
CASTELLANO NRAS TARGETS DN | 14 | 14 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF UP | 215 | 137 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 6 | 84 | 54 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
LE EGR2 TARGETS UP | 108 | 75 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA UP | 207 | 145 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
DELASERNA MYOD TARGETS UP | 89 | 51 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 12 | 79 | 54 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
BOSCO TH1 CYTOTOXIC MODULE | 114 | 62 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 76 | 82 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-129-5p | 85 | 91 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.