Gene Page:CYP39A1
Summary?
GeneID | 51302 |
Symbol | CYP39A1 |
Synonyms | - |
Description | cytochrome P450 family 39 subfamily A member 1 |
Reference | MIM:605994|HGNC:HGNC:17449|Ensembl:ENSG00000146233|HPRD:07067|Vega:OTTHUMG00000014785 |
Gene type | protein-coding |
Map location | 6p12.3 |
Pascal p-value | 0.272 |
Fetal beta | 0.553 |
DMG | 1 (# studies) |
eGene | Cerebellum |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg11574612 | 6 | 46620502 | CYP39A1 | 6.72E-8 | -0.011 | 1.65E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/CYP39A1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005506 | iron ion binding | IEA | - | |
GO:0004497 | monooxygenase activity | IEA | - | |
GO:0020037 | heme binding | IEA | - | |
GO:0008387 | steroid 7-alpha-hydroxylase activity | IEA | - | |
GO:0008396 | oxysterol 7-alpha-hydroxylase activity | EXP | 10748047 | |
GO:0008396 | oxysterol 7-alpha-hydroxylase activity | IDA | 10748047 | |
GO:0009055 | electron carrier activity | IEA | - | |
去:0033782 | 24-hydroxycholesterol 7alpha-hydroxylase activity | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008202 | steroid metabolic process | IEA | - | |
GO:0007586 | digestion | TAS | 10748047 | |
GO:0006707 | cholesterol catabolic process | IEA | - | |
GO:0006699 | bile acid biosynthetic process | IDA | 10748047 | |
GO:0006629 | lipid metabolic process | IEA | - | |
GO:0030573 | bile acid catabolic process | IEA | - | |
GO:0055114 | oxidation reduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005792 | microsome | TAS | 10748047 | |
GO:0005789 | endoplasmic reticulum membrane | EXP | 10748047 | |
GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PRIMARY BILE ACID BIOSYNTHESIS | 16 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME BILE ACID AND BILE SALT METABOLISM | 27 | 11 | All SZGR 2.0 genes in this pathway |
REACTOME SYNTHESIS OF BILE ACIDS AND BILE SALTS VIA 24 HYDROXYCHOLESTEROL | 10 | 6 | All SZGR 2.0 genes in this pathway |
REACTOME SYNTHESIS OF BILE ACIDS AND BILE SALTS | 19 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME BIOLOGICAL OXIDATIONS | 139 | 91 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOCHROME P450 ARRANGED BY SUBSTRATE TYPE | 51 | 34 | All SZGR 2.0 genes in this pathway |
REACTOME PHASE1 FUNCTIONALIZATION OF COMPOUNDS | 70 | 50 | All SZGR 2.0 genes in this pathway |
REACTOME ENDOGENOUS STEROLS | 15 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
YANG BREAST CANCER ESR1 LASER DN | 50 | 38 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM2 | 153 | 102 | All SZGR 2.0 genes in this pathway |
MANTOVANI VIRAL GPCR SIGNALING UP | 86 | 54 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER MYC TGFA UP | 61 | 40 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER MYC E2F1 UP | 56 | 34 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER E2F1 UP | 62 | 35 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY GAMMA RADIATION | 81 | 59 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN | 354 | 216 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
乳腺癌萧述三腔的DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA DN | 267 | 160 | All SZGR 2.0 genes in this pathway |
OHGUCHI LIVER HNF4A TARGETS UP | 44 | 30 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN | 106 | 77 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 351 | 358 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-27 | 352 | 359 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.