Gene Page:CXXC5

Summary?
GeneID 51523
Symbol CXXC5
Synonyms CF5|HSPC195|RINF|WID
Description CXXC finger protein 5
Reference MIM:612752|HGNC:HGNC:26943|Ensembl:ENSG00000171604|HPRD:13105|Vega:OTTHUMG00000163331
Gene type protein-coding
Map location 5q31.2
Pascal p-value 4.515E-5
Sherlock p-value 0.705

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GSMA_I Genome scan meta-analysis Psr: 0.0032

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003677 DNA binding IEA -
GO:0008270 zinc ion binding IEA -
GO:0046872 metal ion binding IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP 285 181 All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA DN 349 157 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE DN 384 220 All SZGR 2.0 genes in this pathway
SAMOLS TARGETS OF KHSV MIRNAS DN 62 35 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP 380 215 All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP 269 146 All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN 260 143 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536 332 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP UP 265 158 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP 137 84 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
CASTELLANO HRAS AND NRAS TARGETS DN 8 6 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN 394 258 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN 165 104 All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP 266 171 All SZGR 2.0 genes in this pathway
WANG IMMORTALIZED BY HOXA9 AND MEIS1 DN 24 15 All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION 405 264 All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER HEREDITARY VS SPORADIC 50 32 All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP 100 72 All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER BRCA1 VS BRCA2 163 113 All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN DN 271 175 All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE 246 153 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN 543 317 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN 540 340 All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871 505 All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP 167 99 All SZGR 2.0 genes in this pathway
LEE EARLY T LYMPHOCYTE UP 107 59 All SZGR 2.0 genes in this pathway
COULOUARN TEMPORAL TGFB1 SIGNATURE DN 138 99 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 DN 45 30 All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721 492 All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION 456 287 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP 387 225 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP 211 131 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP 281 183 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway
ZWANG EGF INTERVAL DN 214 124 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-101 408 414 1A hsa-miR-101 UACAGUACUGUGAUAACUGAAG
miR-144 408 414 1A hsa-miR-144 UACAGUAUAGAUGAUGUACUAG
miR-181 360 366 1A hsa-miR-181abrain AACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZ AACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrain AACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrain AACAUUCAUUGUUGUCGGUGGGUU
miR-186 457 463 m8 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU
miR-188 61 67 m8 hsa-miR-188 CAUCCCUUGCAUGGUGGAGGGU
miR-214 893 900 1A,m8 hsa-miR-214brain ACAGCAGGCACAGACAGGCAG
miR-219 293 300 1A,m8 hsa-miR-219brain UGAUUGUCCAAACGCAAUUCU
miR-25/32/92/363/367 30 36 m8 hsa-miR-25brain CAUUGCACUUGUCUCGGUCUGA
hsa-miR-32 UAUUGCACAUUACUAAGUUGC
hsa-miR-92 UAUUGCACUUGUCCCGGCCUG
hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZ UAUUGCACUCGUCCCGGCCUC
miR-324-5p 84 90 1A hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
miR-363 29 35 m8 hsa-miR-363 AUUGCACGGUAUCCAUCUGUAA
miR-410 139 145 1A hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-496 362 368 1A hsa-miR-496 AUUACAUGGCCAAUCUC