Gene Page:RAB14

Summary?
GeneID 51552
Symbol RAB14
Synonyms FBP|RAB-14
Description RAB14, member RAS oncogene family
Reference MIM:612673|HGNC:HGNC:16524|Ensembl:ENSG00000119396|HPRD:06693|Vega:OTTHUMG00000020582
Gene type protein-coding
Map location 9q33.2
Pascal p-value 0.01
Support INTRACELLULAR TRAFFICKING

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

补充说明:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13- 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0003924 GTPase activity NAS 15004230
GO:0005515 protein binding 新闻学会 17353931
GO:0005525 GTP binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007269 neurotransmitter secretion NAS neuron, axon, Synap, serotonin, Neurotransmitter, dopamine (GO term level: 8) -
GO:0007264 small GTPase mediated signal transduction NAS -
GO:0006895 Golgi to endosome transport TAS 15004230
GO:0016192 vesicle-mediated transport NAS 15004230
GO:0015031 protein transport IEA -
GO:0046907 intracellular transport NAS 15004230
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005791 rough endoplasmic reticulum ISS -
GO:0005795 Golgi stack ISS -
GO:0005829 cytosol ISS -
GO:0005622 intracellular IDA 11256614
GO:0005624 membrane fraction ISS -
GO:0005764 lysosome ISS -
GO:0005769 early endosome ISS -
GO:0005770 late endosome ISS -
GO:0005886 plasma membrane ISS -
GO:0048471 perinuclear region of cytoplasm ISS -
GO:0042175 nuclear envelope-endoplasmic reticulum network ISS -
GO:0030140 trans-Golgi network transport vesicle ISS -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
LIU SOX4 TARGETS DN 309 191 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN 352 225 All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP 404 246 All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP 95 64 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR UP 164 122 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN 485 334 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 UP 121 71 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2A DN 141 84 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER WITH LOH IN CHR9Q 116 71 All SZGR 2.0 genes in this pathway
PETRETTO HEART MASS QTL CIS UP 28 15 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424 268 All SZGR 2.0 genes in this pathway
CHEN LUNG CANCER SURVIVAL 28 22 All SZGR 2.0 genes in this pathway
IIZUKA LIVER CANCER PROGRESSION L1 G1 UP 25 15 All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN 245 154 All SZGR 2.0 genes in this pathway
XU CREBBP TARGETS DN 44 31 All SZGR 2.0 genes in this pathway
JIANG VHL TARGETS 138 91 All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D6 37 25 All SZGR 2.0 genes in this pathway
LEE AGING NEOCORTEX UP 89 59 All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN 312 203 All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS DN 135 88 All SZGR 2.0 genes in this pathway
JIANG AGING CEREBRAL CORTEX DN 54 43 All SZGR 2.0 genes in this pathway
DAIRKEE CANCER PRONE RESPONSE BPA E2 118 65 All SZGR 2.0 genes in this pathway
FLOTHO PEDIATRIC ALL THERAPY RESPONSE UP 53 33 All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 2 86 50 All SZGR 2.0 genes in this pathway
JIANG HYPOXIA VIA VHL 34 24 All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO GONADOTROPHINS UP 91 59 All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO FORSKOLIN UP 90 58 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-101 1052 1058 1A hsa-miR-101 UACAGUACUGUGAUAACUGAAG
miR-124.1 1047 1053 m8 hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
miR-124/506 1047 1053 1A hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-133 1842 1848 m8 hsa-miR-133a UUGGUCCCCUUCAACCAGCUGU
hsa-miR-133b UUGGUCCCCUUCAACCAGCUA
miR-144 1052 1058 1A hsa-miR-144 UACAGUAUAGAUGAUGUACUAG
miR-145 1673 1680 1A,m8 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCUU
miR-185 207 213 m8 hsa-miR-185brain UGGAGAGAAAGGCAGUUC
miR-188 1172 1178 m8 hsa-miR-188 CAUCCCUUGCAUGGUGGAGGGU
miR-19 1088 1094 1A hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
miR-204/211 1283 1290 1A,m8 hsa-miR-204brain UUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
miR-205 663 669 1A hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
miR-214 1852 1858 m8 hsa-miR-214brain ACAGCAGGCACAGACAGGCAG
hsa-miR-214brain ACAGCAGGCACAGACAGGCAG
miR-25/32/92/363/367 1950 1957 1A,m8 hsa-miR-25brain CAUUGCACUUGUCUCGGUCUGA
hsa-miR-32 UAUUGCACAUUACUAAGUUGC
hsa-miR-92 UAUUGCACUUGUCCCGGCCUG
hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZ UAUUGCACUCGUCCCGGCCUC
miR-27 430 436 1A hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-31 1044 1050 m8 hsa-miR-31 AGGCAAGAUGCUGGCAUAGCUG
miR-320 597 603 1A hsa-miR-320 AAAAGCUGGGUUGAGAGGGCGAA
miR-338 294 301 1A,m8 hsa-miR-338brain UCCAGCAUCAGUGAUUUUGUUGA
miR-34b 65 71 m8 hsa-miR-34b UAGGCAGUGUCAUUAGCUGAUUG
miR-381 1644 1650 1A hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
miR-490 177 183 1A hsa-miR-490 CAACCUGGAGGACUCCAUGCUG
miR-500 1948 1955 1A,m8 hsa-miR-500 AUGCACCUGGGCAAGGAUUCUG
miR-544 1683 1690 1A,m8 hsa-miR-544 AUUCUGCAUUUUUAGCAAGU