Gene Page:MED15
Summary?
GeneID | 51586 |
Symbol | MED15 |
Synonyms | ARC105|CAG7A|CTG7A|PCQAP|TIG-1|TIG1|TNRC7 |
Description | mediator complex subunit 15 |
Reference | MIM:607372|HGNC:HGNC:14248|Ensembl:ENSG00000099917|HPRD:12117|Vega:OTTHUMG00000150810 |
Gene type | protein-coding |
Map location | 22q11.2 |
Pascal p-value | 0.002 |
Sherlock p-value | 0.864 |
Fetal beta | -0.487 |
eGene | Caudate basal ganglia Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CNV:YES | Copy number variation studies | Manual curation | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.02 |
部分即遗传学和表观遗传学注释
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs17795337 | chr6 | 136492658 | MED15 | 51586 | 0.08 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/MED15_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | 新闻学会 | 16799563 | |
Biological process | 去term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
Cellular component | 去term | Evidence | Neuro keywords | PubMed ID |
GO:0005794 | Golgi apparatus | IDA | 18029348 | |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | 苏rce | PubMed ID |
---|---|---|---|---|---|
ATP5C1 | ATP5C | ATP5CL1 | ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 | Two-hybrid | BioGRID | 16169070 |
FHL3 | MGC19547 | MGC23614 | MGC8696 | SLIM2 | four and a half LIM domains 3 | Two-hybrid | BioGRID | 16189514 |
MED10 | L6 | MGC5309 | NUT2 | TRG20 | mediator complex subunit 10 | Affinity Capture-MS | BioGRID | 15175163 |
MED19 | DT2P1G7 | LCMR1 | mediator complex subunit 19 | Affinity Capture-MS | BioGRID | 15175163 |
MED25 | ACID1 | ARC92 | DKFZp434K0512 | MGC70671 | P78 | PTOV2 | TCBAP0758 | mediator complex subunit 25 | - | HPRD,BioGRID | 14983011 |
MED26 | CRSP7 | CRSP70 | mediator complex subunit 26 | Affinity Capture-MS | BioGRID | 15175163 |
MED28 | 1500003D12Rik | DKFZp434N185 | EG1 | magicin | mediator complex subunit 28 | Affinity Capture-MS | BioGRID | 15175163 |
MED29 | DKFZp434H247 | IXL | mediator complex subunit 29 | Affinity Capture-MS | BioGRID | 15175163 |
MED6 | NY-REN-28 | mediator complex subunit 6 | Affinity Capture-MS | BioGRID | 14983011 |
MED9 | FLJ10193 | MED25 | MGC138234 | mediator complex subunit 9 | Affinity Capture-MS | BioGRID | 15175163 |
MLLT6 | AF17 | FLJ23480 | myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 | Two-hybrid | BioGRID | 16189514 |
PLSCR1 | MMTRA1B | phospholipid scramblase 1 | Two-hybrid | BioGRID | 16189514 |
SMAD2 | JV18 | JV18-1 | MADH2 | MADR2 | MGC22139 | MGC34440 | hMAD-2 | hSMAD2 | SMAD family member 2 | - | HPRD | 12167862 |
SMAD3 | DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 | SMAD家庭成员3 | - | HPRD | 12167862 |
SMAD4 | DPC4 | JIP | MADH4 | SMAD家庭成员4 | - | HPRD | 12167862 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID SMAD2 3NUCLEAR PATHWAY | 82 | 63 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME PPARA ACTIVATES GENE EXPRESSION | 104 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME GENERIC TRANSCRIPTION PATHWAY | 352 | 181 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM | 168 | 115 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSCRIPTIONAL REGULATION OF WHITE ADIPOCYTE DIFFERENTIATION | 72 | 53 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
LOCKWOOD AMPLIFIED IN LUNG CANCER | 214 | 139 | All SZGR 2.0 genes in this pathway |
OKUMURA INFLAMMATORY RESPONSE LPS | 183 | 115 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
QI HYPOXIA TARGETS OF HIF1A AND FOXA2 | 37 | 27 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
VANOEVELEN MYOGENESIS SIN3A TARGETS | 220 | 133 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-125/351 | 330 | 336 | m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-130/301 | 867 | 873 | 1A | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.