Gene Page:PENK

Summary?
GeneID 5179
Symbol PENK
Synonyms PE | PENK-A
Description proenkephalin
Reference MIM:131330|HGNC:HGNC:8831|Ensembl:ENSG00000181195|HPRD:08837|Vega:OTTHUMG00000164409
Gene type protein-coding
Map location 8q12.1
Pascal p-value 0.48
Fetal beta 0.619
eGene Cerebellar Hemisphere
Myers' cis & trans
Support NEUROTROPHIN SIGNALING

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统的search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs10927978 chr1 14305081 PENK 5179 0.02 trans
rs17110698 chr1 55040550 PENK 5179 0 trans
rs596985 chr1 64277034 PENK 5179 0.12 trans
rs13447530 chr1 91983798 PENK 5179 4.564E-5 trans
rs16838771 chr1 157511227 PENK 5179 4.524E-7 trans
rs1028703 chr1 167270715 PENK 5179 0.01 trans
rs16823145 chr1 184397914 PENK 5179 0.15 trans
rs6713473 chr2 11284414 PENK 5179 0.01 trans
rs17019687 chr2 80972176 PENK 5179 0.07 trans
rs17028172 chr2 103608895 PENK 5179 0.08 trans
rs16829545 chr2 151977407 PENK 5179 0.08 trans
rs16841750 chr2 158288461 PENK 5179 0.12 trans
rs16839485 chr2 208117480 PENK 5179 0.1 trans
rs4378948 0 PENK 5179 0.17 trans
rs1344868 chr3 21311149 PENK 5179 0 trans
rs4627772 0 PENK 5179 0.01 trans
rs17079580 chr3 47363841 PENK 5179 0.01 trans
rs12629522 chr3 59430782 PENK 5179 0.12 trans
rs9879175 chr3 59992485 PENK 5179 0.05 trans
rs2120503 chr3 66779890 PENK 5179 0.12 trans
rs1587651 chr3 79944075 PENK 5179 0.02 trans
rs12637719 chr3 85328350 PENK 5179 0.14 trans
rs9310049 chr3 87236540 PENK 5179 0.03 trans
rs6807632 chr3 111395567 PENK 5179 0.03 trans
rs4689472 chr4 6533060 PENK 5179 0.02 trans
rs7654030 chr4 65592437 PENK 5179 0.19 trans
rs6821203 chr4 189475342 PENK 5179 0.05 trans
rs3111196 chr5 54402889 PENK 5179 0.16 trans
rs16894524 chr5 65192799 PENK 5179 1.872E-4 trans
rs17165234 chr5 126403634 PENK 5179 0.07 trans
rs1194997 chr5 146093747 PENK 5179 0.11 trans
rs6556379 chr5 158399386 PENK 5179 0.01 trans
rs17056426 chr5 158452806 PENK 5179 0.12 trans
rs16871026 chr6 32815487 PENK 5179 0.2 trans
rs794607 chr6 119274656 PENK 5179 0.02 trans
rs10499261 chr6 150283162 PENK 5179 0.07 trans
rs9397728 chr6 150514248 PENK 5179 0 trans
rs7841920 chr8 74581108 PENK 5179 0.09 trans
rs1892129 chr9 21055879 PENK 5179 0.11 trans
rs10968301 chr9 28043905 PENK 5179 0.03 trans
rs16910491 chr9 116673026 PENK 5179 8.564E-4 trans
snp_a-2108530 0 PENK 5179 0.01 trans
rs16922710 chr10 23087297 PENK 5179 0.13 trans
rs16922725 chr10 23100286 PENK 5179 0.17 trans
rs10508654 chr10 23104638 PENK 5179 0.05 trans
rs7081986 chr10 90807242 PENK 5179 0.13 trans
rs4980232 chr10 124577756 PENK 5179 0.03 trans
rs2019626 chr11 41926368 PENK 5179 0.12 trans
rs12580163 chr12 2134197 PENK 5179 0.08 trans
rs11178166 chr12 70670585 PENK 5179 0.18 trans
rs17054789 chr13 37561186 PENK 5179 0.11 trans
rs17054790 chr13 37562620 PENK 5179 0.11 trans
rs336224 chr13 110516305 PENK 5179 0.04 trans
rs17104965 chr14 37145915 PENK 5179 0.01 trans
rs8013398 chr14 61998391 PENK 5179 0.18 trans
rs16955618 chr15 29937543 PENK 5179 0.11 trans
rs2118961 chr15 40614199 PENK 5179 0.03 trans
rs587388 chr16 5518793 PENK 5179 0.12 trans
rs2919431 chr16 30709366 PENK 5179 0.04 trans
rs443222 chr16 83889679 PENK 5179 5.039E-4 trans
rs824575 chr16 83891459 PENK 5179 5.039E-4 trans
rs7210845 chr17 54122025 PENK 5179 2.143E-5 trans
rs12938916 chr17 55866286 PENK 5179 0.08 trans
rs755768 chr17 75023387 PENK 5179 0.09 trans
rs11081028 chr18 3269332 PENK 5179 0.05 trans
snp_a-2036900 0 PENK 5179 0 trans
rs9948702 chr18 34221076 PENK 5179 0.06 trans
rs17680225 chr18 34221269 PENK 5179 0.17 trans
rs8093472 chr18 74145030 PENK 5179 0.19 trans
rs1883720 chr20 12531179 PENK 5179 0.17 trans
rs2832308 chr21 30757493 PENK 5179 9.702E-4 trans
rs7277179 chr21 30758759 PENK 5179 0.03 trans
rs2835891 chr21 39056226 PENK 5179 0.07 trans
rs1894251 chr22 22440498 PENK 5179 0.13 trans
rs6519257 chr22 41889401 PENK 5179 0.01 trans
rs1883665 chrX 17650382 PENK 5179 0 trans
rs7062071 chrX 17724830 PENK 5179 0.02 trans
rs16989685 chrX 31527328 PENK 5179 0.11 trans
rs5972475 chrX 32032409 PENK 5179 1.02E-4 trans
rs17002014 chrX 138237892 PENK 5179 0.01 trans
rs7888371 chrX 138238854 PENK 5179 0.01 trans
rs7887301 chrX 138238881 PENK 5179 0.01 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
FZR1 0.86 0.89
CAPN1 0.86 0.89
UBA1 0.85 0.89
GRWD1 0.85 0.88
PYGB 0.85 0.86
TBCD 0.85 0.88
BBS1 0.85 0.87
SLC39A7 0.84 0.87
RAB11B 0.84 0.89
TELO2 0.84 0.87
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.72 -0.78
MT-CO2 -0.69 -0.77
AF347015.33 -0.68 -0.75
AF347015.27 -0.67 -0.76
AF347015.21 -0.66 -0.78
C5orf53 -0.66 -0.68
MT-CYB -0.65 -0.74
AF347015.8 -0.65 -0.75
IFI27 -0.65 -0.70
AC021016.1 -0.64 -0.71

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005184 neuropeptide hormone activity TAS axon, Synap, Brain, Neurotransmitter (GO term level: 6) 7057924
GO:0001515 opioid peptide activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007218 neuropeptide signaling pathway IEA Neurotransmitter (GO term level: 8) -
GO:0001662 behavioral fear response IEA -
GO:0007165 signal transduction TAS 7057924
GO:0007610 behavior IEA -
GO:0019233 sensory perception of pain IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID AP1 PATHWAY 70 60 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME PEPTIDE LIGAND BINDING RECEPTORS 188 108 All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS 305 177 All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805 368 All SZGR 2.0 genes in this pathway
REACTOME G ALPHA I SIGNALLING EVENTS 195 114 All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408 246 All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER DN 481 290 All SZGR 2.0 genes in this pathway
CORRE MULTIPLE MYELOMA DN 62 41 All SZGR 2.0 genes in this pathway
LANDIS BREAST CANCER PROGRESSION DN 70 43 All SZGR 2.0 genes in this pathway
CASTELLANO NRAS TARGETS UP 68 41 All SZGR 2.0 genes in this pathway
MARKEY RB1 ACUTE LOF DN 228 137 All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST TUMORS 65 DN 37 22 All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST PRENEOPLASTIC DN 55 33 All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST TUMORS 324 DN 149 93 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK UP 116 68 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP 584 356 All SZGR 2.0 genes in this pathway
HOWLIN PUBERTAL MAMMARY GLAND 69 40 All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP 390 236 All SZGR 2.0 genes in this pathway
INGRAM SHH TARGETS UP 127 79 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR UP 116 79 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP 487 286 All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER A 100 63 All SZGR 2.0 genes in this pathway
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN 206 136 All SZGR 2.0 genes in this pathway
BENPORATH苏Z12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
LEE TARGETS OF PTCH1 AND SUFU DN 83 69 All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER UP 49 36 All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION 405 264 All SZGR 2.0 genes in this pathway
TRAYNOR RETT SYNDROM UP 45 33 All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN 153 120 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS DN 57 39 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS UP 37 27 All SZGR 2.0 genes in this pathway
MCCLUNG COCAINE REWARD 5D 79 62 All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP 244 165 All SZGR 2.0 genes in this pathway
ZHU CMV ALL UP 120 89 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP 428 266 All SZGR 2.0 genes in this pathway
ZHU CMV 24 HR UP 93 65 All SZGR 2.0 genes in this pathway
LOPES METHYLATED IN COLON CANCER UP 27 20 All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER T4 94 69 All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P4 100 62 All SZGR 2.0 genes in this pathway
BERNARD PPAPDC1B TARGETS UP 40 20 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP 149 85 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 16 26 17 All SZGR 2.0 genes in this pathway
VALK AML WITH 11Q23 REARRANGED 22 13 All SZGR 2.0 genes in this pathway
YAGI AML WITH T 9 11 TRANSLOCATION 130 87 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349 234 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341 243 All SZGR 2.0 genes in this pathway
BILANGES SERUM SENSITIVE GENES 90 54 All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP 364 236 All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1 467 251 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-200bc/429 185 192 1A,m8 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU