Gene Page:PFKFB2

Summary?
GeneID 5208
Symbol PFKFB2
Synonyms PFK-2/FBPase-2
Description 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Reference MIM:171835|HGNC:HGNC:8873|Ensembl:ENSG00000123836|HPRD:01383|Vega:OTTHUMG00000036033
Gene type protein-coding
Map location 1q31
Fetal beta -1.77

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0296

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0003873 6-phosphofructo-2-kinase activity EXP 9464277
GO:0003873 6-phosphofructo-2-kinase activity TAS 9652401
GO:0005524 ATP binding IEA -
GO:0004331 fructose-2,6-bisphosphate 2-phosphatase activity IEA -
GO:0016787 hydrolase activity IEA -
GO:0016740 transferase activity IEA -
GO:0016301 kinase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006003 fructose 2,6-bisphosphate metabolic process IEA -
GO:0008152 metabolic process IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005829 cytosol EXP 9464277

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG FRUCTOSE AND MANNOSE METABOLISM 34 23 All SZGR 2.0 genes in this pathway
REACTOME GLYCOLYSIS 29 18 All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF CARBOHYDRATES 247 154 All SZGR 2.0 genes in this pathway
REACTOME GLUCOSE METABOLISM 69 42 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805 505 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537 339 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A UP 191 128 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037 673 All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS UP 214 133 All SZGR 2.0 genes in this pathway
CHEN LVAD SUPPORT OF FAILING HEART DN 42 32 All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN 161 105 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 720 440 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN 366 257 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD2 DN 46 29 All SZGR 2.0 genes in this pathway
MOOTHA GLYCOLYSIS 21 13 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP 682 433 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS DN 109 71 All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP 364 236 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-26 5418 5424 1A hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU